SUCLG1 cDNA ORF Clone, Rat, untagged

Cat: RG81160-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SUCLG1 Reagents
CRO Services
Product recommended

All SUCLG1 Reagents
SUCLG1 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Rat succinate-CoA ligase, alpha subunit.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SUCLG1 Background Information
Full Name
succinate-CoA ligase, alpha subunit

SUCLG1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SUCLG1 cDNA ORF Clone in Cloning Vector, Rat RG81160-U
SUCLG1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81160-ACG
SUCLG1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81160-ACGLN
SUCLG1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81160-ANG
SUCLG1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81160-ACR
SUCLG1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81160-ANR
SUCLG1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81160-CF
SUCLG1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81160-NF
SUCLG1 cDNA ORF Clone, Rat, C-His tag RG81160-CH
SUCLG1 cDNA ORF Clone, Rat, N-His tag RG81160-NH
SUCLG1 cDNA ORF Clone, Rat, C-HA tag RG81160-CY
SUCLG1 cDNA ORF Clone, Rat, N-HA tag RG81160-NY
SUCLG1 cDNA ORF Clone, Rat, C-Myc tag RG81160-CM
SUCLG1 cDNA ORF Clone, Rat, N-Myc tag RG81160-NM
SUCLG1 qPCR Primer Pairs, Rat RP301116

SUCLG1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SUCLG1 cDNA ORF Clone in Cloning Vector, Mouse MG51437-G
SUCLG1 cDNA ORF Clone, Mouse, untagged MG51437-UT
SUCLG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51437-ACGLN
SUCLG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51437-ACG
SUCLG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51437-ANG
SUCLG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51437-ACR
SUCLG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51437-ANR
SUCLG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51437-CF
SUCLG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51437-NF
SUCLG1 cDNA ORF Clone, Mouse, C-His tag MG51437-CH
SUCLG1 cDNA ORF Clone, Mouse, N-His tag MG51437-NH
SUCLG1 cDNA ORF Clone, Mouse, C-HA tag MG51437-CY
SUCLG1 cDNA ORF Clone, Mouse, N-HA tag MG51437-NY
SUCLG1 cDNA ORF Clone, Mouse, C-Myc tag MG51437-CM
SUCLG1 cDNA ORF Clone, Mouse, N-Myc tag MG51437-NM
SUCLG1 qPCR Primer Pairs, Mouse MP201321

SUCLG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SUCLG1 cDNA ORF Clone in Cloning Vector, Human HG20782-U
SUCLG1 cDNA ORF Clone, Human, untagged HG20782-UT
SUCLG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20782-ACGLN
SUCLG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG20782-ACG
SUCLG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG20782-ANG
SUCLG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG20782-ACR
SUCLG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG20782-ANR
SUCLG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20782-CF
SUCLG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20782-NF
SUCLG1 cDNA ORF Clone, Human, C-His tag HG20782-CH
SUCLG1 cDNA ORF Clone, Human, N-His tag HG20782-NH
SUCLG1 cDNA ORF Clone, Human, C-HA tag HG20782-CY
SUCLG1 cDNA ORF Clone, Human, N-HA tag HG20782-NY
SUCLG1 cDNA ORF Clone, Human, C-Myc tag HG20782-CM
SUCLG1 cDNA ORF Clone, Human, N-Myc tag HG20782-NM
info info
添加购物车成功! 添加购物车失败!