Text Size:AAA

Rat STXBP3/UNC-18C Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat STXBP3 cDNA Clone Product Information
    NCBI RefSeq:NM_053637.2
    RefSeq ORF Size:1782bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus syntaxin binding protein 3 with C terminal Myc tag.
    Gene Synonym:Munc18-c
    Species:Rat
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with STXBP3 qPCR primers for gene expression analysis, RP300563 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Syntaxin-binding protein 3, also known as Platelet Sec1 protein, Protein unc-18 homolog 3, Protein unc-18 homolog C, Unc-18C, Unc18-3 and STXBP3, is a cytoplasm protein which belongs to the STXBP/unc-18/SEC1 family. STXBP3 is expressed in cells that exhibit granule exocytosis, such as neutrophils, mast cells, platelets and endothelial cells. STXBP3, together with STX4 and VAMP2, may play a role in insulin-dependent movement of GLUT4 and in docking / fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes. STXBP3 participates in the consolidation and secretion of secondary and tertiary granules. STXBP3 contains one SEC1 domain. Phosphorylation at Ser129 may stimulate granule release. Human STXBP3 shares 90% aa identity with mouse STXBP3. STXBP3 interacts with DOC2B; the interaction is direct, occurs at the cell membrane, excludes interaction with STX4 and regulates glucose-stimulated insulin secretion. Interacts with STX4.

    References
  • Kidd,M. et al., 2008, Am J Physiol Gastrointest Liver Physiol. 295 (2): G260-72.
  • Macedo,C. et al., 2008, Mol Cell Biochem. 318 (1-2): 63-71.
  • Size / Price
    Catalog: RG80599-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"