After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat STXBP3/UNC-18C Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Rat STXBP3 cDNA Clone Product Information
NCBI RefSeq:NM_053637.2
RefSeq ORF Size:1782bp
cDNA Description:Full length Clone DNA of Rattus norvegicus syntaxin binding protein 3 with C terminal His tag.
Gene Synonym:Munc18-c
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Syntaxin-binding protein 3, also known as Platelet Sec1 protein, Protein unc-18 homolog 3, Protein unc-18 homolog C, Unc-18C, Unc18-3 and STXBP3, is a cytoplasm protein which belongs to the STXBP/unc-18/SEC1 family. STXBP3 is expressed in cells that exhibit granule exocytosis, such as neutrophils, mast cells, platelets and endothelial cells. STXBP3, together with STX4 and VAMP2, may play a role in insulin-dependent movement of GLUT4 and in docking / fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes. STXBP3 participates in the consolidation and secretion of secondary and tertiary granules. STXBP3 contains one SEC1 domain. Phosphorylation at Ser129 may stimulate granule release. Human STXBP3 shares 90% aa identity with mouse STXBP3. STXBP3 interacts with DOC2B; the interaction is direct, occurs at the cell membrane, excludes interaction with STX4 and regulates glucose-stimulated insulin secretion. Interacts with STX4.

References
  • Kidd,M. et al., 2008, Am J Physiol Gastrointest Liver Physiol. 295 (2): G260-72.
  • Macedo,C. et al., 2008, Mol Cell Biochem. 318 (1-2): 63-71.
  • Size / Price
    Catalog: RG80599-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"