STIP1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80600-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All STIP1 Reagents
CRO Services
Product recommended

All STIP1 Reagents
STIP1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1632 bp
Description
Full length Clone DNA of Rat stress-induced phosphoprotein 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STIP1 Background Information
Full Name
stress induced phosphoprotein 1

STIP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STIP1 cDNA ORF Clone in Cloning Vector, Rat RG80600-U
STIP1 cDNA ORF Clone, Rat, untagged RG80600-UT
STIP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80600-ACGLN
STIP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80600-ACG
STIP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80600-ANG
STIP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80600-ACR
STIP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80600-ANR
STIP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80600-CF
STIP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80600-NF
STIP1 cDNA ORF Clone, Rat, N-His tag RG80600-NH
STIP1 cDNA ORF Clone, Rat, C-HA tag RG80600-CY
STIP1 cDNA ORF Clone, Rat, N-HA tag RG80600-NY
STIP1 cDNA ORF Clone, Rat, C-Myc tag RG80600-CM
STIP1 cDNA ORF Clone, Rat, N-Myc tag RG80600-NM
STIP1 qPCR Primer Pairs, Rat RP300564

STIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STIP1 cDNA ORF Clone in Cloning Vector, Mouse MG52725-U
STIP1 cDNA ORF Clone, Mouse, untagged MG52725-UT
STIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52725-ACGLN
STIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52725-ACG
STIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52725-ANG
STIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52725-ACR
STIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52725-ANR
STIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52725-CF
STIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52725-NF
STIP1 cDNA ORF Clone, Mouse, C-His tag MG52725-CH
STIP1 cDNA ORF Clone, Mouse, N-His tag MG52725-NH
STIP1 cDNA ORF Clone, Mouse, C-HA tag MG52725-CY
STIP1 cDNA ORF Clone, Mouse, N-HA tag MG52725-NY
STIP1 cDNA ORF Clone, Mouse, C-Myc tag MG52725-CM
STIP1 cDNA ORF Clone, Mouse, N-Myc tag MG52725-NM
STIP1 qPCR Primer Pairs, Mouse MP202596

STIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STIP1 cDNA ORF Clone in Cloning Vector, Human HG16371-G
STIP1 cDNA ORF Clone, Human, untagged HG16371-UT
STIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16371-ACGLN
STIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16371-ACG
STIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16371-ANG
STIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16371-ACR
STIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16371-ANR
STIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16371-CF
STIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16371-NF
STIP1 cDNA ORF Clone, Human, C-His tag HG16371-CH
STIP1 cDNA ORF Clone, Human, N-His tag HG16371-NH
STIP1 cDNA ORF Clone, Human, C-HA tag HG16371-CY
STIP1 cDNA ORF Clone, Human, N-HA tag HG16371-NY
STIP1 cDNA ORF Clone, Human, C-Myc tag HG16371-CM
STIP1 cDNA ORF Clone, Human, N-Myc tag HG16371-NM
STIP1 qPCR Primer Pairs, Human HP105121
info info
添加购物车成功! 添加购物车失败!