STAT6 cDNA ORF Clone, Rat, untagged

Cat: RG81196-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STAT6 Reagents
CRO Services
Product recommended

All STAT6 Reagents
STAT6 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2526 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 804T/C,2154C/T not causing the amino acid variation.
Description
Full length Clone DNA of Rat signal transducer and activator of transcription 6, interleukin-4 induced.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+2.53kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
STAT6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAT6 cDNA ORF Clone, Rat, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
STAT6 Background Information

Signal transducer and activator of transcription 6 (STAT6) is a transcription factor that is activated by interleukin-4 (IL-4)-induced tyrosine phosphorylation and mediates most of the IL-4-induced gene expression. STAT6 plays a central role in exerting interleukin-4 (IL-4) mediated biological responses and is found to induce the expression of BCL2L1/BCL-XL, which is responsible for the anti-apoptotic activity of IL4. Transcriptional activation by STAT6 requires the interaction with coactivators like p300 and the CREB-binding protein (CBP). NF-?B and tyrosine-phosphorylated Stat6 can directly bind each other in vitro and in vivo, which suggest that the direct interaction between Stat6 and NF-?B may provide a basis for synergistic activation of transcription by IL-4 and activators of NF-?B. 

Full Name
signal transducer and activator of transcription 6, interleukin-4 induced
References
  • Litterst CM, et al. (2001) Transcriptional activation by STAT6 requires the direct interaction with NCoA-1. J Biol Chem. 276 (49): 45713-21.
  • Stutz AM, et al. (1999) Functional synergism of STAT6 with either NF-kappa B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol. 163 (8): 4383-91.
  • Yang J, et al. (2002) Identification of p100 as a coactivator for STAT6 that bridges STAT6 with RNA polymerase II. EMBO J. 21 (18): 4950-8.
  • STAT6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    STAT6 cDNA ORF Clone in Cloning Vector, Rat RG81196-U
    STAT6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81196-ACGLN
    STAT6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81196-ACG
    STAT6 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81196-ANG
    STAT6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81196-ACR
    STAT6 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81196-ANR
    STAT6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81196-CF
    STAT6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81196-NF
    STAT6 cDNA ORF Clone, Rat, C-His tag RG81196-CH
    STAT6 cDNA ORF Clone, Rat, N-His tag RG81196-NH
    STAT6 cDNA ORF Clone, Rat, C-HA tag RG81196-CY
    STAT6 cDNA ORF Clone, Rat, N-HA tag RG81196-NY
    STAT6 cDNA ORF Clone, Rat, C-Myc tag RG81196-CM
    STAT6 cDNA ORF Clone, Rat, N-Myc tag RG81196-NM
    STAT6 qPCR Primer Pairs, Rat RP301152

    STAT6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    STAT6 cDNA ORF Clone in Cloning Vector, Mouse MG52975-U
    STAT6 cDNA ORF Clone, Mouse, untagged MG52975-UT
    STAT6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52975-ACG
    STAT6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52975-ACGLN
    STAT6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52975-ANG
    STAT6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52975-ACR
    STAT6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52975-ANR
    STAT6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52975-CF
    STAT6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52975-NF
    STAT6 cDNA ORF Clone, Mouse, C-His tag MG52975-CH
    STAT6 cDNA ORF Clone, Mouse, N-His tag MG52975-NH
    STAT6 cDNA ORF Clone, Mouse, C-HA tag MG52975-CY
    STAT6 cDNA ORF Clone, Mouse, N-HA tag MG52975-NY
    STAT6 cDNA ORF Clone, Mouse, C-Myc tag MG52975-CM
    STAT6 cDNA ORF Clone, Mouse, N-Myc tag MG52975-NM

    STAT6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    STAT6 cDNA ORF Clone in Cloning Vector, Human HG13190-G
    STAT6 cDNA ORF Clone, Human, untagged HG13190-UT
    STAT6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13190-ACGLN
    STAT6 cDNA ORF Clone, Human, C-GFPSpark® tag HG13190-ACG
    STAT6 cDNA ORF Clone, Human, N-GFPSpark® tag HG13190-ANG
    STAT6 cDNA ORF Clone, Human, C-OFPSpark® tag HG13190-ACR
    STAT6 cDNA ORF Clone, Human, N-OFPSpark® tag HG13190-ANR
    STAT6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13190-CF
    STAT6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13190-NF
    STAT6 cDNA ORF Clone, Human, C-His tag HG13190-CH
    STAT6 cDNA ORF Clone, Human, N-His tag HG13190-NH
    STAT6 cDNA ORF Clone, Human, C-HA tag HG13190-CY
    STAT6 cDNA ORF Clone, Human, N-HA tag HG13190-NY
    STAT6 cDNA ORF Clone, Human, C-Myc tag HG13190-CM
    STAT6 cDNA ORF Clone, Human, N-Myc tag HG13190-NM
    STAT6 qPCR Primer Pairs, Human HP102337
    info info
    添加购物车成功! 添加购物车失败!