SSR2 cDNA ORF Clone, Rat, C-His tag

Cat: RG81625-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SSR2 Reagents

CRO Services

Product recommended


All SSR2 Reagents

SSR2 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
552 bp
Description
Full length Clone DNA of Rat signal sequence receptor, beta with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SSR2 Background Information

Full Name
signal sequence receptor, beta (translocon-associated protein beta)

SSR2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SSR2 cDNA ORF Clone in Cloning Vector, Rat RG81625-U
SSR2 cDNA ORF Clone, Rat, untagged RG81625-UT
SSR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81625-ACGLN
SSR2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81625-ACG
SSR2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81625-ANG
SSR2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81625-ACR
SSR2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81625-ANR
SSR2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81625-CF
SSR2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81625-NF
SSR2 cDNA ORF Clone, Rat, N-His tag RG81625-NH
SSR2 cDNA ORF Clone, Rat, C-HA tag RG81625-CY
SSR2 cDNA ORF Clone, Rat, N-HA tag RG81625-NY
SSR2 cDNA ORF Clone, Rat, C-Myc tag RG81625-CM
SSR2 cDNA ORF Clone, Rat, N-Myc tag RG81625-NM

SSR2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SSR2 cDNA ORF Clone in Cloning Vector, Mouse MG53319-U
SSR2 cDNA ORF Clone, Mouse, untagged MG53319-UT
SSR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53319-ACG
SSR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53319-ACGLN
SSR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53319-ACR
SSR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53319-CF
SSR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53319-NF
SSR2 cDNA ORF Clone, Mouse, C-His tag MG53319-CH
SSR2 cDNA ORF Clone, Mouse, N-His tag MG53319-NH
SSR2 cDNA ORF Clone, Mouse, C-HA tag MG53319-CY
SSR2 cDNA ORF Clone, Mouse, N-HA tag MG53319-NY
SSR2 cDNA ORF Clone, Mouse, C-Myc tag MG53319-CM
SSR2 cDNA ORF Clone, Mouse, N-Myc tag MG53319-NM

SSR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SSR2 cDNA ORF Clone in Cloning Vector, Human HG16411-G
SSR2 cDNA ORF Clone, Human, untagged HG16411-UT
SSR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16411-ACG
SSR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16411-ACGLN
SSR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16411-ACR
SSR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16411-CF
SSR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16411-NF
SSR2 cDNA ORF Clone, Human, C-His tag HG16411-CH
SSR2 cDNA ORF Clone, Human, N-His tag HG16411-NH
SSR2 cDNA ORF Clone, Human, C-HA tag HG16411-CY
SSR2 cDNA ORF Clone, Human, N-HA tag HG16411-NY
SSR2 cDNA ORF Clone, Human, C-Myc tag HG16411-CM
SSR2 cDNA ORF Clone, Human, N-Myc tag HG16411-NM
SSR2 qPCR Primer Pairs, Human HP105160
info info
添加购物车成功! 添加购物车失败!