SRSF7 cDNA ORF Clone, Rat, untagged

Cat: RG81295-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SRSF7 Reagents
CRO Services
Product recommended

All SRSF7 Reagents
SRSF7 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
474 bp
Description
Full length Clone DNA of Rat serine/arginine-rich splicing factor 7.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRSF7 Background Information
Full Name
serine/arginine-rich splicing factor 7

SRSF7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SRSF7 cDNA ORF Clone in Cloning Vector, Rat RG81295-U
SRSF7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81295-ACG
SRSF7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81295-ACGLN
SRSF7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81295-ANG
SRSF7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81295-ACR
SRSF7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81295-ANR
SRSF7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81295-CF
SRSF7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81295-NF
SRSF7 cDNA ORF Clone, Rat, C-His tag RG81295-CH
SRSF7 cDNA ORF Clone, Rat, N-His tag RG81295-NH
SRSF7 cDNA ORF Clone, Rat, C-HA tag RG81295-CY
SRSF7 cDNA ORF Clone, Rat, N-HA tag RG81295-NY
SRSF7 cDNA ORF Clone, Rat, C-Myc tag RG81295-CM
SRSF7 cDNA ORF Clone, Rat, N-Myc tag RG81295-NM
SRSF7 qPCR Primer Pairs, Rat RP301251

SRSF7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRSF7 cDNA ORF Clone in Cloning Vector, Mouse MG5A7545-U
SRSF7 cDNA ORF Clone in Cloning Vector, Mouse MG52130-U
SRSF7 cDNA ORF Clone, Mouse, untagged MG5A7545-UT
SRSF7 cDNA ORF Clone, Mouse, untagged MG52130-UT
SRSF7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52130-ACG
SRSF7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7545-ACGLN
SRSF7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7545-ACG
SRSF7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52130-ACGLN
SRSF7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7545-ANG
SRSF7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52130-ANG
SRSF7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52130-ACR
SRSF7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7545-ACR
SRSF7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7545-ANR
SRSF7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52130-ANR
SRSF7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7545-CF
SRSF7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52130-CF
SRSF7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52130-NF
SRSF7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7545-NF
SRSF7 cDNA ORF Clone, Mouse, C-His tag MG5A7545-CH
SRSF7 cDNA ORF Clone, Mouse, C-His tag MG52130-CH
SRSF7 cDNA ORF Clone, Mouse, N-His tag MG52130-NH
SRSF7 cDNA ORF Clone, Mouse, N-His tag MG5A7545-NH
SRSF7 cDNA ORF Clone, Mouse, C-HA tag MG52130-CY
SRSF7 cDNA ORF Clone, Mouse, C-HA tag MG5A7545-CY
SRSF7 cDNA ORF Clone, Mouse, N-HA tag MG52130-NY
SRSF7 cDNA ORF Clone, Mouse, N-HA tag MG5A7545-NY
SRSF7 cDNA ORF Clone, Mouse, C-Myc tag MG52130-CM
SRSF7 cDNA ORF Clone, Mouse, C-Myc tag MG5A7545-CM
SRSF7 cDNA ORF Clone, Mouse, N-Myc tag MG52130-NM
SRSF7 cDNA ORF Clone, Mouse, N-Myc tag MG5A7545-NM
SRSF7 qPCR Primer Pairs, Mouse MP202003

SRSF7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRSF7 cDNA ORF Clone in Cloning Vector, Human HG16837-U
SRSF7 cDNA ORF Clone, Human, untagged HG16837-UT
SRSF7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16837-ACG
SRSF7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16837-ACGLN
SRSF7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16837-ANG
SRSF7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16837-ACR
SRSF7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16837-ANR
SRSF7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16837-CF
SRSF7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16837-NF
SRSF7 cDNA ORF Clone, Human, C-His tag HG16837-CH
SRSF7 cDNA ORF Clone, Human, N-His tag HG16837-NH
SRSF7 cDNA ORF Clone, Human, C-HA tag HG16837-CY
SRSF7 cDNA ORF Clone, Human, N-HA tag HG16837-NY
SRSF7 cDNA ORF Clone, Human, C-Myc tag HG16837-CM
SRSF7 cDNA ORF Clone, Human, N-Myc tag HG16837-NM
info info
添加购物车成功! 添加购物车失败!