SR1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80964-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SR1 Reagents
CRO Services
Product recommended

All SR1 Reagents
SR1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Rat sorcin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SR1 Background Information

Sorcin was originally identified in multidrug-resistant cells. It is a alcium-binding protein. Sorcin modulates excitation-contraction coupling in the heart, contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Sorcin is overexpressed in the multi-drug resistant chinese hamster ovary cell line CHRC5 and a variety of multidrug-resistant tumor cell lines, but overexpression is not a sufficient or necessary condition for the acquisition of the multidrug-resistant phenotype.

Full Name
sorcin
References
  • Meyers MB, et al. (1995) Association of sorcin with the cardiac ryanodine receptor. J Biol Chem. 270(44):26411-8.
  • Brownawell AM, et al. (1997) Calcium-dependent binding of sorcin to the N-terminal domain of synexin (annexin VII). J Biol Chem. 272(35):22182-90.
  • Hansen, et al. (2003) The PEF family proteins sorcin and grancalcin interact in vivo and in vitro. FEBS Lett. 545(2-3):151-4.
  • SR1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SR1 cDNA ORF Clone in Cloning Vector, Rat RG80964-U
    SR1 cDNA ORF Clone, Rat, untagged RG80964-UT
    SR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80964-ACG
    SR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80964-ACGLN
    SR1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80964-ANG
    SR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80964-ACR
    SR1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80964-ANR
    SR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80964-CF
    SR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80964-NF
    SR1 cDNA ORF Clone, Rat, C-His tag RG80964-CH
    SR1 cDNA ORF Clone, Rat, N-His tag RG80964-NH
    SR1 cDNA ORF Clone, Rat, C-HA tag RG80964-CY
    SR1 cDNA ORF Clone, Rat, N-HA tag RG80964-NY
    SR1 cDNA ORF Clone, Rat, C-Myc tag RG80964-CM
    SR1 qPCR Primer Pairs, Rat RP300928

    SR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SR1 cDNA ORF Clone in Cloning Vector, Mouse MG52957-G
    SR1 cDNA ORF Clone, Mouse, untagged MG52957-UT
    SR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52957-ACG
    SR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52957-ACGLN
    SR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52957-ANG
    SR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52957-ACR
    SR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52957-ANR
    SR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52957-CF
    SR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52957-NF
    SR1 cDNA ORF Clone, Mouse, C-His tag MG52957-CH
    SR1 cDNA ORF Clone, Mouse, N-His tag MG52957-NH
    SR1 cDNA ORF Clone, Mouse, C-HA tag MG52957-CY
    SR1 cDNA ORF Clone, Mouse, N-HA tag MG52957-NY
    SR1 cDNA ORF Clone, Mouse, C-Myc tag MG52957-CM
    SR1 cDNA ORF Clone, Mouse, N-Myc tag MG52957-NM
    info info
    添加购物车成功! 添加购物车失败!