SPTSSA cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81173-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPTSSA Reagents
CRO Services
Product recommended

All SPTSSA Reagents
SPTSSA cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
216 bp
Description
Full length Clone DNA of Rat serine palmitoyltransferase, small subunit A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPTSSA Background Information
Full Name
serine palmitoyltransferase, small subunit A

SPTSSA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SPTSSA cDNA ORF Clone in Cloning Vector, Rat RG81173-U
SPTSSA cDNA ORF Clone, Rat, untagged RG81173-UT
SPTSSA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81173-ACGLN
SPTSSA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81173-ACG
SPTSSA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81173-ACR
SPTSSA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81173-NF
SPTSSA cDNA ORF Clone, Rat, C-His tag RG81173-CH
SPTSSA cDNA ORF Clone, Rat, N-His tag RG81173-NH
SPTSSA cDNA ORF Clone, Rat, C-HA tag RG81173-CY
SPTSSA cDNA ORF Clone, Rat, N-HA tag RG81173-NY
SPTSSA cDNA ORF Clone, Rat, C-Myc tag RG81173-CM
SPTSSA cDNA ORF Clone, Rat, N-Myc tag RG81173-NM
SPTSSA qPCR Primer Pairs, Rat RP301129

SPTSSA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPTSSA cDNA ORF Clone in Cloning Vector, Mouse MG52378-U
SPTSSA cDNA ORF Clone, Mouse, untagged MG52378-UT
SPTSSA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52378-ACGLN
SPTSSA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52378-ACG
SPTSSA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52378-ANG
SPTSSA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52378-ACR
SPTSSA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52378-ANR
SPTSSA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52378-CF
SPTSSA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52378-NF
SPTSSA cDNA ORF Clone, Mouse, C-His tag MG52378-CH
SPTSSA cDNA ORF Clone, Mouse, N-His tag MG52378-NH
SPTSSA cDNA ORF Clone, Mouse, C-HA tag MG52378-CY
SPTSSA cDNA ORF Clone, Mouse, N-HA tag MG52378-NY
SPTSSA cDNA ORF Clone, Mouse, C-Myc tag MG52378-CM
SPTSSA cDNA ORF Clone, Mouse, N-Myc tag MG52378-NM
SPTSSA qPCR Primer Pairs, Mouse MP202251

SPTSSA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPTSSA cDNA ORF Clone in Cloning Vector, Human HG16786-U
SPTSSA cDNA ORF Clone, Human, untagged HG16786-UT
SPTSSA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16786-ACGLN
SPTSSA cDNA ORF Clone, Human, C-GFPSpark® tag HG16786-ACG
SPTSSA cDNA ORF Clone, Human, C-OFPSpark® tag HG16786-ACR
SPTSSA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16786-CF
SPTSSA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16786-NF
SPTSSA cDNA ORF Clone, Human, C-His tag HG16786-CH
SPTSSA cDNA ORF Clone, Human, N-His tag HG16786-NH
SPTSSA cDNA ORF Clone, Human, C-HA tag HG16786-CY
SPTSSA cDNA ORF Clone, Human, N-HA tag HG16786-NY
SPTSSA cDNA ORF Clone, Human, C-Myc tag HG16786-CM
SPTSSA cDNA ORF Clone, Human, N-Myc tag HG16786-NM
info info
添加购物车成功! 添加购物车失败!