SPARC cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80870-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPARC Reagents
CRO Services
Product recommended

All SPARC Reagents
SPARC cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Rat secreted protein, acidic, cysteine-rich (osteonectin) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPARC cDNA ORF Clone, Rat, N-Myc tag Alternative Names
SPARC cDNA ORF Clone, Rat
SPARC Background Information

Secreted protein acidic and rich in cysteine (SPARC), also known as Osteonectin (ON), is a member of the SPARC family. SPARC consists of three domains: a EF-hand domain, a follistatin-like domain and a Kazal-like domain, and each of which has independent activity and unique properties. The activity of SPARC is context- and cell-type-dependent, which is highlighted by the fact that SPARC has shown seemingly contradictory effects on tumor progression in both clinical correlative studies and in animal models. The location of SPARC in the nuclear matrix of certain proliferating cells, but only in the cytosol of postmitotic neurons, indicates potential functions of SPARC as a nuclear protein, which might be involved in the regulation of cell cycle progression and mitosis. It functions not only to modulate cell-cell and cell-matrix interactions, but its de-adhesive and growth inhibitory properties in non-transformed cells have led to studies to assess its role in cancer. Its divergent actions reflect the complexity of this protein, because in certain types of cancers, such as melanomas and gliomas, SPARC is associated with a highly aggressive tumor phenotype, while in others, mainly ovarian, neuroblastomas and colorectal cancers, SPARC may function as a tumor suppressor. Recent studies have also demonstrated a role for SPARC in sensitizing therapy-resistant cancers. Notably, SPARC is linked to human obesity.

Full Name
secreted protein, acidic, cysteine-rich (osteonectin)
References
  • Yan Q, et al. (1999) SPARC, a matricellular glycoprotein with important biological functions. J Histochem Cytochem. 47(12): 1495-506.
  • Brekken RA, et al. (2000) SPARC, a matricellular protein: at the crossroads of cell-matrix. Matrix Biol. 19(7): 569-80.
  • Tai IT, et al. (2008) SPARC in cancer biology: its role in cancer progression and potential for therapy. Drug Resist Updat. 11(6): 231-46.
  • Podhajcer OL, et al. (2008) The role of the matricellular protein SPARC in the dynamic interaction between the tumor and the host. Cancer Metastasis Rev. 27(3): 523-37.
  • Kos K, et al. (2010) SPARC: a key player in the pathologies associated with obesity and diabetes. Nat Rev Endocrinol. 6(4): 225-35.
  • SPARC cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SPARC cDNA ORF Clone in Cloning Vector, Rat RG80870-U
    SPARC cDNA ORF Clone, Rat, untagged RG80870-UT
    SPARC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80870-ACGLN
    SPARC cDNA ORF Clone, Rat, C-GFPSpark® tag RG80870-ACG
    SPARC cDNA ORF Clone, Rat, C-OFPSpark® tag RG80870-ACR
    SPARC cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80870-CF
    SPARC cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80870-NF
    SPARC cDNA ORF Clone, Rat, C-His tag RG80870-CH
    SPARC cDNA ORF Clone, Rat, N-His tag RG80870-NH
    SPARC cDNA ORF Clone, Rat, C-HA tag RG80870-CY
    SPARC cDNA ORF Clone, Rat, N-HA tag RG80870-NY
    SPARC cDNA ORF Clone, Rat, C-Myc tag RG80870-CM
    SPARC qPCR Primer Pairs, Rat RP300834

    SPARC cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SPARC cDNA ORF Clone in Cloning Vector, Mouse MG50494-M
    SPARC cDNA ORF Clone, Mouse, untagged MG50494-UT
    SPARC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50494-ACGLN
    SPARC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50494-ACG
    SPARC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50494-ACR
    SPARC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50494-CF
    SPARC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50494-NF
    SPARC cDNA ORF Clone, Mouse, C-His tag MG50494-CH
    SPARC cDNA ORF Clone, Mouse, N-His tag MG50494-NH
    SPARC cDNA ORF Clone, Mouse, C-HA tag MG50494-CY
    SPARC cDNA ORF Clone, Mouse, N-HA tag MG50494-NY
    SPARC cDNA ORF Clone, Mouse, C-Myc tag MG50494-CM
    SPARC cDNA ORF Clone, Mouse, N-Myc tag MG50494-NM
    SPARC qPCR Primer Pairs, Mouse MP200488

    SPARC cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SPARC cDNA ORF Clone in Cloning Vector, Human HG10929-M
    SPARC cDNA ORF Clone, Human, untagged HG10929-UT
    SPARC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10929-ACGLN
    SPARC cDNA ORF Clone, Human, C-GFPSpark® tag HG10929-ACG
    SPARC cDNA ORF Clone, Human, C-OFPSpark® tag HG10929-ACR
    SPARC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10929-CF
    SPARC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10929-NF
    SPARC cDNA ORF Clone, Human, C-His tag HG10929-CH
    SPARC cDNA ORF Clone, Human, N-His tag HG10929-NH
    SPARC cDNA ORF Clone, Human, C-HA tag HG10929-CY
    SPARC cDNA ORF Clone, Human, N-HA tag HG10929-NY
    SPARC cDNA ORF Clone, Human, C-Myc tag HG10929-CM
    SPARC cDNA ORF Clone, Human, N-Myc tag HG10929-NM
    SPARC qPCR Primer Pairs, Human HP100810
    info info
    添加购物车成功! 添加购物车失败!