Quick Order

Rat Sclerostin/SOST Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat SOST cDNA Clone Product Information
    NCBI RefSeq:NM_030584.1
    RefSeq ORF Size:1314bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus sclerosteosis with C terminal Myc tag.
    Gene Synonym:VBCH, SOST
    Species:Rat
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SOST qPCR primers for gene expression analysis, RP300008 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Sclerostin, the protein product of the SOST gene, is a potent inhibitor of bone formation. Sclerostin protein is widely expressed at low levels with highest levels in bone, cartilage, kidney, liver, bone marrow and primary osteeoblasts differentiated for 21 days, and was originally identified as an important regulator of bone remodeling, homeostasis, and links bone resorption and bone apposition. Recent studies have revealed that Sclerostin protein inhibits the bone growth probably by binding to the extracellular domain of the Wnt coreceptors LRP5 and LRP6 and disrupting Wnt-induced Frizzled-LRP complex formation.

    References
  • Bellido T. (2006) Downregulation of SOST/sclerostin by PTH: a novel mechanism of hormonal control of bone formation mediated by osteocytes. J Musculoskelet Neuronal Interact. 6(4): 358-9.
  • van Bezooijen RL, et al. (2007) SOST expression is restricted to the great arteries during embryonic and neonatal cardiovascular development. Dev Dyn. 236(2): 606-12.
  • Size / Price
    Catalog: RG80009-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"