Quick Order

Rat Sclerostin/SOST Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat SOST cDNA Clone Product Information
NCBI RefSeq:NM_030584.1
RefSeq ORF Size:1314bp
cDNA Description:Full length Clone DNA of Rattus norvegicus sclerosteosis with C terminal Flag tag.
Gene Synonym:VBCH, SOST
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Sclerostin, the protein product of the SOST gene, is a potent inhibitor of bone formation. Sclerostin protein is widely expressed at low levels with highest levels in bone, cartilage, kidney, liver, bone marrow and primary osteeoblasts differentiated for 21 days, and was originally identified as an important regulator of bone remodeling, homeostasis, and links bone resorption and bone apposition. Recent studies have revealed that Sclerostin protein inhibits the bone growth probably by binding to the extracellular domain of the Wnt coreceptors LRP5 and LRP6 and disrupting Wnt-induced Frizzled-LRP complex formation.

References
  • Bellido T. (2006) Downregulation of SOST/sclerostin by PTH: a novel mechanism of hormonal control of bone formation mediated by osteocytes. J Musculoskelet Neuronal Interact. 6(4): 358-9.
  • van Bezooijen RL, et al. (2007) SOST expression is restricted to the great arteries during embryonic and neonatal cardiovascular development. Dev Dyn. 236(2): 606-12.
  • Size / Price
    Catalog: RG80009-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"