SMIM14 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80733-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SMIM14 Reagents
CRO Services
Product recommended

All SMIM14 Reagents
SMIM14 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
300 bp
Description
Full length Clone DNA of Rat small integral membrane protein 14 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMIM14 Background Information
Full Name
small integral membrane protein 14

SMIM14 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SMIM14 cDNA ORF Clone in Cloning Vector, Rat RG80733-U
SMIM14 cDNA ORF Clone, Rat, untagged RG80733-UT
SMIM14 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80733-ACG
SMIM14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80733-ACGLN
SMIM14 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80733-ACR
SMIM14 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80733-CF
SMIM14 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80733-NF
SMIM14 cDNA ORF Clone, Rat, C-His tag RG80733-CH
SMIM14 cDNA ORF Clone, Rat, N-His tag RG80733-NH
SMIM14 cDNA ORF Clone, Rat, C-HA tag RG80733-CY
SMIM14 cDNA ORF Clone, Rat, N-HA tag RG80733-NY
SMIM14 cDNA ORF Clone, Rat, C-Myc tag RG80733-CM
SMIM14 qPCR Primer Pairs, Rat RP300697

SMIM14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SMIM14 cDNA ORF Clone in Cloning Vector, Mouse MG52788-G
SMIM14 cDNA ORF Clone, Mouse, untagged MG52788-UT
SMIM14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52788-ACGLN
SMIM14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52788-ACG
SMIM14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52788-ANG
SMIM14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52788-ACR
SMIM14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52788-ANR
SMIM14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52788-CF
SMIM14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52788-NF
SMIM14 cDNA ORF Clone, Mouse, C-His tag MG52788-CH
SMIM14 cDNA ORF Clone, Mouse, N-His tag MG52788-NH
SMIM14 cDNA ORF Clone, Mouse, C-HA tag MG52788-CY
SMIM14 cDNA ORF Clone, Mouse, N-HA tag MG52788-NY
SMIM14 cDNA ORF Clone, Mouse, C-Myc tag MG52788-CM
SMIM14 cDNA ORF Clone, Mouse, N-Myc tag MG52788-NM

SMIM14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SMIM14 cDNA ORF Clone in Cloning Vector, Human HG26244-U
SMIM14 cDNA ORF Clone, Human, untagged HG26244-UT
SMIM14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26244-ACGLN
SMIM14 cDNA ORF Clone, Human, C-GFPSpark® tag HG26244-ACG
SMIM14 cDNA ORF Clone, Human, N-GFPSpark® tag HG26244-ANG
SMIM14 cDNA ORF Clone, Human, C-OFPSpark® tag HG26244-ACR
SMIM14 cDNA ORF Clone, Human, N-OFPSpark® tag HG26244-ANR
SMIM14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26244-CF
SMIM14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26244-NF
SMIM14 cDNA ORF Clone, Human, C-His tag HG26244-CH
SMIM14 cDNA ORF Clone, Human, N-His tag HG26244-NH
SMIM14 cDNA ORF Clone, Human, C-HA tag HG26244-CY
SMIM14 cDNA ORF Clone, Human, N-HA tag HG26244-NY
SMIM14 cDNA ORF Clone, Human, C-Myc tag HG26244-CM
SMIM14 cDNA ORF Clone, Human, N-Myc tag HG26244-NM
info info
添加购物车成功! 添加购物车失败!