SMCR7 cDNA ORF Clone, Rat, untagged

Cat: RG81104-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SMCR7 Reagents
CRO Services
Product recommended

All SMCR7 Reagents
SMCR7 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1365 bp
Description
Full length Clone DNA of Rat Smith-Magenis syndrome chromosome region, candidate 7.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMCR7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SMCR7 cDNA ORF Clone in Cloning Vector, Rat RG81104-U
SMCR7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81104-ACG
SMCR7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81104-ACGLN
SMCR7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81104-ANG
SMCR7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81104-ACR
SMCR7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81104-ANR
SMCR7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81104-CF
SMCR7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81104-NF
SMCR7 cDNA ORF Clone, Rat, C-His tag RG81104-CH
SMCR7 cDNA ORF Clone, Rat, N-His tag RG81104-NH
SMCR7 cDNA ORF Clone, Rat, C-HA tag RG81104-CY
SMCR7 cDNA ORF Clone, Rat, N-HA tag RG81104-NY
SMCR7 cDNA ORF Clone, Rat, C-Myc tag RG81104-CM
SMCR7 cDNA ORF Clone, Rat, N-Myc tag RG81104-NM
SMCR7 qPCR Primer Pairs, Rat RP301061

SMCR7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SMCR7 cDNA ORF Clone in Cloning Vector, Human HG14912-G
SMCR7 cDNA ORF Clone, Human, untagged HG14912-UT
SMCR7 cDNA ORF Clone, Human, C-GFPSpark® tag HG14912-ACG
SMCR7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14912-ACGLN
SMCR7 cDNA ORF Clone, Human, C-OFPSpark® tag HG14912-ACR
SMCR7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14912-CF
SMCR7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14912-NF
SMCR7 cDNA ORF Clone, Human, C-His tag HG14912-CH
SMCR7 cDNA ORF Clone, Human, N-His tag HG14912-NH
SMCR7 cDNA ORF Clone, Human, C-HA tag HG14912-CY
SMCR7 cDNA ORF Clone, Human, N-HA tag HG14912-NY
SMCR7 cDNA ORF Clone, Human, C-Myc tag HG14912-CM
SMCR7 cDNA ORF Clone, Human, N-Myc tag HG14912-NM
SMCR7 qPCR Primer Pairs, Human HP103541
info info
添加购物车成功! 添加购物车失败!