SLC7A9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81255-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SLC7A9 Reagents
CRO Services
Product recommended

All SLC7A9 Reagents
SLC7A9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1464 bp
Description
Full length Clone DNA of Rat solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC7A9 Background Information
Full Name
solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9

SLC7A9 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC7A9 cDNA ORF Clone in Cloning Vector, Rat RG81255-U
SLC7A9 cDNA ORF Clone, Rat, untagged RG81255-UT
SLC7A9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81255-ACG
SLC7A9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81255-ACGLN
SLC7A9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81255-ACR
SLC7A9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81255-NF
SLC7A9 cDNA ORF Clone, Rat, C-His tag RG81255-CH
SLC7A9 cDNA ORF Clone, Rat, N-His tag RG81255-NH
SLC7A9 cDNA ORF Clone, Rat, C-HA tag RG81255-CY
SLC7A9 cDNA ORF Clone, Rat, N-HA tag RG81255-NY
SLC7A9 cDNA ORF Clone, Rat, C-Myc tag RG81255-CM
SLC7A9 cDNA ORF Clone, Rat, N-Myc tag RG81255-NM
SLC7A9 qPCR Primer Pairs, Rat RP301211

SLC7A9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC7A9 cDNA ORF Clone in Cloning Vector, Mouse MG5A1803-U
SLC7A9 cDNA ORF Clone, Mouse, untagged MG5A1803-UT
SLC7A9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1803-ACGLN
SLC7A9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1803-ACG
SLC7A9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1803-ANG
SLC7A9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1803-ACR
SLC7A9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1803-ANR
SLC7A9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1803-CF
SLC7A9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1803-NF
SLC7A9 cDNA ORF Clone, Mouse, C-His tag MG5A1803-CH
SLC7A9 cDNA ORF Clone, Mouse, N-His tag MG5A1803-NH
SLC7A9 cDNA ORF Clone, Mouse, C-HA tag MG5A1803-CY
SLC7A9 cDNA ORF Clone, Mouse, N-HA tag MG5A1803-NY
SLC7A9 cDNA ORF Clone, Mouse, C-Myc tag MG5A1803-CM
SLC7A9 cDNA ORF Clone, Mouse, N-Myc tag MG5A1803-NM

SLC7A9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC7A9 cDNA ORF Clone in Cloning Vector, Human HG17514-G
SLC7A9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17514-ACGLN
info info
添加购物车成功! 添加购物车失败!