SLC29A1 cDNA ORF Clone, Rat, N-His tag

Cat: RG80504-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC29A1 Reagents
CRO Services
Product recommended

All SLC29A1 Reagents
SLC29A1 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1374 bp
Description
Full length Clone DNA of Rat solute carrier family 29 (nucleoside transporters), member 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC29A1 Background Information
Full Name
solute carrier family 29 (equilibrative nucleoside transporter), member 1

SLC29A1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC29A1 cDNA ORF Clone in Cloning Vector, Rat RG80504-U
SLC29A1 cDNA ORF Clone, Rat, untagged RG80504-UT
SLC29A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80504-ACG
SLC29A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80504-ACGLN
SLC29A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80504-ACR
SLC29A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80504-CF
SLC29A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80504-NF
SLC29A1 cDNA ORF Clone, Rat, C-His tag RG80504-CH
SLC29A1 cDNA ORF Clone, Rat, C-HA tag RG80504-CY
SLC29A1 cDNA ORF Clone, Rat, N-HA tag RG80504-NY
SLC29A1 cDNA ORF Clone, Rat, C-Myc tag RG80504-CM
SLC29A1 cDNA ORF Clone, Rat, N-Myc tag RG80504-NM
SLC29A1 qPCR Primer Pairs, Rat RP300468

SLC29A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC29A1 cDNA ORF Clone in Cloning Vector, Mouse MG53114-U
SLC29A1 cDNA ORF Clone, Mouse, untagged MG53114-UT
SLC29A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53114-ACG
SLC29A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53114-ACGLN
SLC29A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53114-ANG
SLC29A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53114-ACR
SLC29A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53114-ANR
SLC29A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53114-CF
SLC29A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53114-NF
SLC29A1 cDNA ORF Clone, Mouse, C-His tag MG53114-CH
SLC29A1 cDNA ORF Clone, Mouse, N-His tag MG53114-NH
SLC29A1 cDNA ORF Clone, Mouse, C-HA tag MG53114-CY
SLC29A1 cDNA ORF Clone, Mouse, N-HA tag MG53114-NY
SLC29A1 cDNA ORF Clone, Mouse, C-Myc tag MG53114-CM
SLC29A1 cDNA ORF Clone, Mouse, N-Myc tag MG53114-NM

SLC29A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC29A1 cDNA ORF Clone in Cloning Vector, Human HG17799-U
SLC29A1 cDNA ORF Clone, Human, untagged HG17799-UT
SLC29A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17799-ACG
SLC29A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17799-ACGLN
SLC29A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17799-ANG
SLC29A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17799-ACR
SLC29A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17799-ANR
SLC29A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17799-CF
SLC29A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17799-NF
SLC29A1 cDNA ORF Clone, Human, C-His tag HG17799-CH
SLC29A1 cDNA ORF Clone, Human, N-His tag HG17799-NH
SLC29A1 cDNA ORF Clone, Human, C-HA tag HG17799-CY
SLC29A1 cDNA ORF Clone, Human, N-HA tag HG17799-NY
SLC29A1 cDNA ORF Clone, Human, C-Myc tag HG17799-CM
SLC29A1 cDNA ORF Clone, Human, N-Myc tag HG17799-NM
info info
添加购物车成功! 添加购物车失败!