SLC25A4 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80673-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A4 Reagents
CRO Services
Product recommended

All SLC25A4 Reagents
SLC25A4 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Rat solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A4 Background Information
Full Name
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4

SLC25A4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SLC25A4 cDNA ORF Clone in Cloning Vector, Rhesus CG90700-G
SLC25A4 cDNA ORF Clone, Rhesus, untagged CG90700-UT
SLC25A4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90700-ACG
SLC25A4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90700-ACGLN
SLC25A4 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90700-ANG
SLC25A4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90700-ACR
SLC25A4 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90700-ANR
SLC25A4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90700-CF
SLC25A4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90700-NF
SLC25A4 cDNA ORF Clone, Rhesus, C-His tag CG90700-CH
SLC25A4 cDNA ORF Clone, Rhesus, N-His tag CG90700-NH
SLC25A4 cDNA ORF Clone, Rhesus, C-HA tag CG90700-CY
SLC25A4 cDNA ORF Clone, Rhesus, N-HA tag CG90700-NY
SLC25A4 cDNA ORF Clone, Rhesus, C-Myc tag CG90700-CM
SLC25A4 cDNA ORF Clone, Rhesus, N-Myc tag CG90700-NM

SLC25A4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A4 cDNA ORF Clone in Cloning Vector, Rat RG80673-U
SLC25A4 cDNA ORF Clone, Rat, untagged RG80673-UT
SLC25A4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80673-ACGLN
SLC25A4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80673-ACG
SLC25A4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80673-ANG
SLC25A4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80673-ACR
SLC25A4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80673-ANR
SLC25A4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80673-CF
SLC25A4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80673-NF
SLC25A4 cDNA ORF Clone, Rat, C-His tag RG80673-CH
SLC25A4 cDNA ORF Clone, Rat, N-His tag RG80673-NH
SLC25A4 cDNA ORF Clone, Rat, N-HA tag RG80673-NY
SLC25A4 cDNA ORF Clone, Rat, C-Myc tag RG80673-CM
SLC25A4 cDNA ORF Clone, Rat, N-Myc tag RG80673-NM
SLC25A4 qPCR Primer Pairs, Rat RP300637

SLC25A4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A4 cDNA ORF Clone in Cloning Vector, Mouse MG51579-G
SLC25A4 cDNA ORF Clone, Mouse, untagged MG51579-UT
SLC25A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51579-ACGLN
SLC25A4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51579-ACG
SLC25A4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51579-ANG
SLC25A4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51579-ACR
SLC25A4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51579-ANR
SLC25A4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51579-CF
SLC25A4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51579-NF
SLC25A4 cDNA ORF Clone, Mouse, C-His tag MG51579-CH
SLC25A4 cDNA ORF Clone, Mouse, N-His tag MG51579-NH
SLC25A4 cDNA ORF Clone, Mouse, C-HA tag MG51579-CY
SLC25A4 cDNA ORF Clone, Mouse, N-HA tag MG51579-NY
SLC25A4 cDNA ORF Clone, Mouse, C-Myc tag MG51579-CM
SLC25A4 cDNA ORF Clone, Mouse, N-Myc tag MG51579-NM
SLC25A4 qPCR Primer Pairs, Mouse MP201462

SLC25A4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A4 cDNA ORF Clone in Cloning Vector, Human HG17969-U
SLC25A4 cDNA ORF Clone, Human, untagged HG17969-UT
SLC25A4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17969-ACGLN
SLC25A4 cDNA ORF Clone, Human, C-GFPSpark® tag HG17969-ACG
SLC25A4 cDNA ORF Clone, Human, N-GFPSpark® tag HG17969-ANG
SLC25A4 cDNA ORF Clone, Human, C-OFPSpark® tag HG17969-ACR
SLC25A4 cDNA ORF Clone, Human, N-OFPSpark® tag HG17969-ANR
SLC25A4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17969-CF
SLC25A4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17969-NF
SLC25A4 cDNA ORF Clone, Human, C-His tag HG17969-CH
SLC25A4 cDNA ORF Clone, Human, N-His tag HG17969-NH
SLC25A4 cDNA ORF Clone, Human, C-HA tag HG17969-CY
SLC25A4 cDNA ORF Clone, Human, N-HA tag HG17969-NY
SLC25A4 cDNA ORF Clone, Human, C-Myc tag HG17969-CM
SLC25A4 cDNA ORF Clone, Human, N-Myc tag HG17969-NM
info info
添加购物车成功! 添加购物车失败!