SIRT5 cDNA ORF Clone, Rat, untagged

Cat: RG81260-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SIRT5 Reagents
CRO Services
Product recommended

All SIRT5 Reagents
SIRT5 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
933 bp
Description
Full length Clone DNA of Rat sirtuin 5.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRT5 Background Information
Full Name
sirtuin 5

SIRT5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SIRT5 cDNA ORF Clone in Cloning Vector, Rat RG81260-U
SIRT5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81260-ACGLN
SIRT5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81260-ACG
SIRT5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81260-ANG
SIRT5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81260-ACR
SIRT5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81260-ANR
SIRT5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81260-CF
SIRT5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81260-NF
SIRT5 cDNA ORF Clone, Rat, C-His tag RG81260-CH
SIRT5 cDNA ORF Clone, Rat, N-His tag RG81260-NH
SIRT5 cDNA ORF Clone, Rat, C-HA tag RG81260-CY
SIRT5 cDNA ORF Clone, Rat, N-HA tag RG81260-NY
SIRT5 cDNA ORF Clone, Rat, C-Myc tag RG81260-CM
SIRT5 cDNA ORF Clone, Rat, N-Myc tag RG81260-NM
SIRT5 qPCR Primer Pairs, Rat RP301216

SIRT5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SIRT5 cDNA ORF Clone in Cloning Vector, Mouse MG50483-M
SIRT5 cDNA ORF Clone, Mouse, untagged MG50483-UT
SIRT5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50483-ACG
SIRT5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50483-ACGLN
SIRT5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50483-ANG
SIRT5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50483-ACR
SIRT5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50483-ANR
SIRT5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50483-CF
SIRT5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50483-NF
SIRT5 cDNA ORF Clone, Mouse, C-His tag MG50483-CH
SIRT5 cDNA ORF Clone, Mouse, N-His tag MG50483-NH
SIRT5 cDNA ORF Clone, Mouse, C-HA tag MG50483-CY
SIRT5 cDNA ORF Clone, Mouse, N-HA tag MG50483-NY
SIRT5 cDNA ORF Clone, Mouse, C-Myc tag MG50483-CM
SIRT5 cDNA ORF Clone, Mouse, N-Myc tag MG50483-NM
SIRT5 qPCR Primer Pairs, Mouse MP200477

SIRT5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SIRT5 cDNA ORF Clone, Human, untagged HG19202-UT
SIRT5 cDNA ORF Clone, Human, C-His tag HG19202-CH
info info
添加购物车成功! 添加购物车失败!