Quick Order

Rat SIRPA/SIRP alpha/CD172a Gene ORF cDNA clone expression plasmid, N-Flag tag

  • Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
DatasheetReviewsRelated ProductsProtocols
Rat SIRPA cDNA Clone Product Information
NCBI RefSeq:NM_013016.2
RefSeq ORF Size:1524 bp
cDNA Description:Full length Clone DNA of Rattus norvegicus signal-regulatory protein alpha with N terminal Flag tag.
Gene Synonym:Bit, Ptpns1, SHPS-1, Sirpa
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-SP-Flag-ratSIRPA
Restriction Site:KpnI + XbaI(6kb+1.52kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SIRPA qPCR primers for gene expression analysis, RP300388 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Tyrosine-protein phosphatase non-receptor type substrate 1, also known as SHP substrate 1, Inhibitory receptor SHPS-1, Brain Ig-like molecule with tyrosine-based activation motifs, Macrophage fusion receptor, CD172 antigen-like family member A, SIRPA and CD172a, is a single-pass type I membrane protein which contains two Ig-like C1-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. SIRPA is ubiquitously expressed. It is highly expressed in brain and detected at lower levels in heart, placenta, lung, testis, ovary, colon, liver, small intestine, prostate, spleen, kidney, skeletal muscle and pancreas. It is also detected on myeloid cells, but not T-cells. SIRPA is an immunoglobulin-like cell surface receptor for CD47. SIRPA acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. SIRPA supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. It may play a key role in intracellular signaling during synaptogenesis and in synaptic function. SIRPA is involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. It mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Timms JF. et al., 1999, Curr Biol. 9: 927-30.
  • Stofega MR. et al., 2000, J Biol Chem. 275: 28222-9.
  • Liu T. et al., 2005, J Proteome Res. 4: 2070-80.
  • Wolf-Yadlin A. et al., 2007, Proc Natl Acad Sci. 104: 5860-5.
  • Size / Price
    Catalog: RG80270-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"