SGK1/SGK cDNA ORF Clone, Rat, N-HA tag

Cat: RG80593-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SGK1/SGK Reagents
CRO Services
Product recommended

All SGK1/SGK Reagents
SGK1/SGK cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1296 bp
Description
Full length Clone DNA of Rat serum/glucocorticoid regulated kinase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SGK1/SGK Background Information
Full Name
serum/glucocorticoid regulated kinase 1

SGK1/SGK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SGK1/SGK cDNA ORF Clone in Cloning Vector, Rat RG80593-U
SGK1/SGK cDNA ORF Clone, Rat, untagged RG80593-UT
SGK1/SGK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80593-ACGLN
SGK1/SGK cDNA ORF Clone, Rat, C-GFPSpark® tag RG80593-ACG
SGK1/SGK cDNA ORF Clone, Rat, N-GFPSpark® tag RG80593-ANG
SGK1/SGK cDNA ORF Clone, Rat, C-OFPSpark® tag RG80593-ACR
SGK1/SGK cDNA ORF Clone, Rat, N-OFPSpark® tag RG80593-ANR
SGK1/SGK cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80593-CF
SGK1/SGK cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80593-NF
SGK1/SGK cDNA ORF Clone, Rat, C-His tag RG80593-CH
SGK1/SGK cDNA ORF Clone, Rat, N-His tag RG80593-NH
SGK1/SGK cDNA ORF Clone, Rat, C-HA tag RG80593-CY
SGK1/SGK cDNA ORF Clone, Rat, C-Myc tag RG80593-CM
SGK1/SGK cDNA ORF Clone, Rat, N-Myc tag RG80593-NM
SGK1/SGK qPCR Primer Pairs, Rat RP300557

SGK1/SGK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SGK1/SGK cDNA ORF Clone in Cloning Vector, Mouse MG50278-M
SGK1/SGK cDNA ORF Clone, Mouse, untagged MG50278-UT
SGK1/SGK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50278-ACG
SGK1/SGK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50278-ACGLN
SGK1/SGK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50278-ACR
SGK1/SGK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50278-CF
SGK1/SGK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50278-NF
SGK1/SGK cDNA ORF Clone, Mouse, C-His tag MG50278-CH
SGK1/SGK cDNA ORF Clone, Mouse, N-His tag MG50278-NH
SGK1/SGK cDNA ORF Clone, Mouse, C-HA tag MG50278-CY
SGK1/SGK cDNA ORF Clone, Mouse, N-HA tag MG50278-NY
SGK1/SGK cDNA ORF Clone, Mouse, C-Myc tag MG50278-CM
SGK1/SGK cDNA ORF Clone, Mouse, N-Myc tag MG50278-NM
SGK1/SGK qPCR Primer Pairs, Mouse MP200302

SGK1/SGK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SGK1/SGK cDNA ORF Clone in Cloning Vector, Human HG10543-M
SGK1/SGK cDNA ORF Clone, Human, untagged HG10543-UT
SGK1/SGK cDNA ORF Clone, Human, C-GFPSpark® tag HG10543-ACG
SGK1/SGK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10543-ACGLN
SGK1/SGK cDNA ORF Clone, Human, N-GFPSpark® tag HG10543-ANG
SGK1/SGK cDNA ORF Clone, Human, C-OFPSpark® tag HG10543-ACR
SGK1/SGK cDNA ORF Clone, Human, N-OFPSpark® tag HG10543-ANR
SGK1/SGK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10543-CF
SGK1/SGK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10543-NF
SGK1/SGK cDNA ORF Clone, Human, C-His tag HG10543-CH
SGK1/SGK cDNA ORF Clone, Human, N-His tag HG10543-NH
SGK1/SGK cDNA ORF Clone, Human, C-HA tag HG10543-CY
SGK1/SGK cDNA ORF Clone, Human, N-HA tag HG10543-NY
SGK1/SGK cDNA ORF Clone, Human, C-Myc tag HG10543-CM
SGK1/SGK cDNA ORF Clone, Human, N-Myc tag HG10543-NM
SGK1/SGK qPCR Primer Pairs, Human HP100559
info info
添加购物车成功! 添加购物车失败!