Surfactant protein D cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80256-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Surfactant protein D Reagents
CRO Services
Product recommended

All Surfactant protein D Reagents
Surfactant protein D cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Rat surfactant protein D with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Surfactant protein D Background Information

Surfactant pulmonary-associated protein D, also known as SFTPD and SP-D, is a member of the collectin family of C-type lectins that is synthesized in many tissues including respiratory epithelial cells in the lung, and contains one C-type lectin domain and one collagen-like domain. The polymorphic variation in the N-terminal domain of the SP-D molecule influences oligomerization, function, and the concentration of the molecule in serum. SFTPD is produced primarily by alveolar type II cells and nonciliated bronchiolar cells in the lung and is constitutively secreted into the alveoli where it influences surfactant homeostasis, effector cell functions, and host defense. It is upregulated in a variety of inflammatory and infectious conditions including Pneumocystis pneumonia and asthma. SFTPD is humoral molecules of the innate immune system, and is considered a functional candidate in chronic periodontitis. Besides it is involved in the development of acute and chronic inflammation of the lung. Several human lung diseases are characterized by decreased levels of bronchoalveolar SFTPD. Thus, recombinant SFTPD has been proposed as a therapeutical option for cystic fibrosis, neonatal lung disease and smoking-induced emphysema. Furthermore, SFTPD serum levels can be used as disease activity markers for interstitial lung diseases.

Full Name
surfactant protein D
References
  • Leth-Larsen R, et al. (2005) A common polymorphism in the SFTPD gene influences assembly, function, and concentration of surfactant protein D. J Immunol. 174(3): 1532-8.
  • Moran AP, et al. (2005) Role of surfactant protein D (SP-D) in innate immunity in the gastric mucosa: evidence of interaction with Helicobacter pylori lipopolysaccharide. J Endotoxin Res. 11(6): 357-62.
  • Hartl D, et al. (2006) Surfactant protein D in human lung diseases. Eur J Clin Invest. 36(6): 423-35.
  • Krueger M, et al. (2006) Amino acid variants in Surfactant protein D are not associated with bronchial asthma. Pediatr Allergy Immunol. 17(1): 77-81.
  • Glas J, et al. (2008) Increased plasma concentration of surfactant protein D in chronic periodontitis independent of SFTPD genotype: potential role as a biomarker. Tissue Antigens. 72(1): 21-8.
  • Surfactant protein D cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Surfactant protein D cDNA ORF Clone in Cloning Vector, Rhesus CG90003-G
    Surfactant protein D cDNA ORF Clone, Rhesus, untagged CG90003-UT
    Surfactant protein D cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90003-ACG
    Surfactant protein D Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90003-ACGLN
    Surfactant protein D cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90003-ACR
    Surfactant protein D cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90003-CF
    Surfactant protein D cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90003-NF
    Surfactant protein D cDNA ORF Clone, Rhesus, C-His tag CG90003-CH
    Surfactant protein D cDNA ORF Clone, Rhesus, N-His tag CG90003-NH
    Surfactant protein D cDNA ORF Clone, Rhesus, C-HA tag CG90003-CY
    Surfactant protein D cDNA ORF Clone, Rhesus, N-HA tag CG90003-NY
    Surfactant protein D cDNA ORF Clone, Rhesus, C-Myc tag CG90003-CM
    Surfactant protein D cDNA ORF Clone, Rhesus, N-Myc tag CG90003-NM

    Surfactant protein D cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Surfactant protein D cDNA ORF Clone in Cloning Vector, Rat RG80256-G
    Surfactant protein D cDNA ORF Clone, Rat, untagged RG80256-UT
    Surfactant protein D Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80256-ACGLN
    Surfactant protein D cDNA ORF Clone, Rat, C-GFPSpark® tag RG80256-ACG
    Surfactant protein D cDNA ORF Clone, Rat, C-OFPSpark® tag RG80256-ACR
    Surfactant protein D cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80256-CF
    Surfactant protein D cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80256-NF
    Surfactant protein D cDNA ORF Clone, Rat, C-His tag RG80256-CH
    Surfactant protein D cDNA ORF Clone, Rat, N-His tag RG80256-NH
    Surfactant protein D cDNA ORF Clone, Rat, C-HA tag RG80256-CY
    Surfactant protein D cDNA ORF Clone, Rat, N-HA tag RG80256-NY
    Surfactant protein D cDNA ORF Clone, Rat, N-Myc tag RG80256-NM
    Surfactant protein D qPCR Primer Pairs, Rat RP300241

    Surfactant protein D cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Surfactant protein D cDNA ORF Clone in Cloning Vector, Mouse MG50205-M
    Surfactant protein D cDNA ORF Clone, Mouse, untagged MG50205-UT
    Surfactant protein D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50205-ACG
    Surfactant protein D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50205-ACGLN
    Surfactant protein D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50205-ACR
    Surfactant protein D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50205-CF
    Surfactant protein D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50205-NF
    Surfactant protein D cDNA ORF Clone, Mouse, C-His tag MG50205-CH
    Surfactant protein D cDNA ORF Clone, Mouse, N-His tag MG50205-NH
    Surfactant protein D cDNA ORF Clone, Mouse, C-HA tag MG50205-CY
    Surfactant protein D cDNA ORF Clone, Mouse, N-HA tag MG50205-NY
    Surfactant protein D cDNA ORF Clone, Mouse, C-Myc tag MG50205-CM
    Surfactant protein D cDNA ORF Clone, Mouse, N-Myc tag MG50205-NM
    Surfactant protein D qPCR Primer Pairs, Mouse MP200233

    Surfactant protein D cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Surfactant protein D cDNA ORF Clone in Cloning Vector, Human HG11041-M
    Surfactant protein D cDNA ORF Clone, Human, untagged HG11041-UT
    Surfactant protein D cDNA ORF Clone, Human, C-GFPSpark® tag HG11041-ACG
    Surfactant protein D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11041-ACGLN
    Surfactant protein D cDNA ORF Clone, Human, C-OFPSpark® tag HG11041-ACR
    Surfactant protein D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11041-CF
    Surfactant protein D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11041-NF
    Surfactant protein D cDNA ORF Clone, Human, C-His tag HG11041-CH
    Surfactant protein D cDNA ORF Clone, Human, N-His tag HG11041-NH
    Surfactant protein D cDNA ORF Clone, Human, C-HA tag HG11041-CY
    Surfactant protein D cDNA ORF Clone, Human, N-HA tag HG11041-NY
    Surfactant protein D cDNA ORF Clone, Human, C-Myc tag HG11041-CM
    Surfactant protein D cDNA ORF Clone, Human, N-Myc tag HG11041-NM
    Surfactant protein D qPCR Primer Pairs, Human HP100997
    info info
    添加购物车成功! 添加购物车失败!