Quick Order

Rat SerpinF2 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Rat SERPINF2 cDNA Clone Product Information
    NCBI RefSeq:NM_001011892.1
    RefSeq ORF Size:1476bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 with C terminal HA tag.
    Gene Synonym:Serpinf2
    Species:Rat
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SerpinF2 qPCR primers for gene expression analysis, RP300651 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    SerpinF2, also known as alpha-2 antiplasmin (alpha-2 AP), is a member of the Serpin superfamily. SerpinF2 is the principal physiological inhibitor of serine protease plasmin, and as well as, an efficient inhibitor of trypsin and chymotrypsin. This protease is produced mainly by liver and kidney, and also expressed in muscle, intestine, central nervous system, and placenta also express this protein at a moderate level. It is indicated that Serpin F2 is a key regulator of plasmin-mediated proteolysis in these tissues. Alpha-2 AP is an unusual serpin in that it contains extensive N- and C-terminal sequences flanking the serpin domain. The N-terminal sequence is crosslinked to fibrin by factor XIIIa, whereas the C-terminal region mediates the initial interaction with plasmin. SerpinF2 is one of the inhibitors of fibrinolysis, which acts as the primary inhibitor of plasmin(ogen). It is a specific plasmin inhibitor, and is important in modulating the effectiveness and persistence of fibrin with respect to its susceptibility to digestion and removal by plasmin. Alpha-2 AP plays the dominant role in inhibiting both plasma clot lysis and thrombus lysis, and accordingly, the congenital deficiency of Alpha-2 antiplasmin causes a rare bleeding disorder because of increased fibrinolysis. Thus, it may be a useful target for developing more effective treatment of thrombotic diseases.

    References
  • Lee KN, et al. (2004) Alpha2-antiplasmin: potential therapeutic roles in fibrin survival and removal. Curr Med Chem Cardiovasc Hematol Agents. 2(4): 303-10.
  • Matsuno H. (2006) Alpha2-antiplasmin on cardiovascular diseases. Curr Pharm Des. 12(7): 841-7.
  • Burnouf T, et al. (2007) Impact of Triton X-100 on alpha 2-antiplasmin (SERPINF2) activity in solvent/detergent-treated plasma. Biologicals. 35(4): 349-53.
  • Carpenter SL, et al. (2008) Alpha2-antiplasmin and its deficiency: fibrinolysis out of balance. Haemophilia. 14(6): 1250-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"