Quick Order

Rat SerpinB12 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat SERPINB12 cDNA Clone Product Information
NCBI RefSeq:NM_001135867.1
RefSeq ORF Size:1266bp
cDNA Description:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade B (ovalbumin), member 12.
Gene Synonym:RGD1566382
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Most serpins are secreted and attain physiologic concentrations in the blood and extracellular fluids. Mouse SerpinB12 is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. It is expressed in many tissues, including brain, bone marrow, lymph node, heart, lung, liver, pancreas, testis, ovary, and intestine. SerpinB12 inhibits trypsin and plasmin, but not thrombin, coagulation factor Xa, or urokinase-type plasminogen activator.

References
  • Askew,Y.S. et al., 2001, J Biol Chem. 276 (52):49320-30.
  • Rawlings, ND. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, PJ. et al., 2009, Pancreas. 38 (4): 461-7.
  • Size / Price
    Catalog: RG81216-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"