Quick Order

Rat SerpinA1 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Rat SERPINA1 cDNA Clone Product Information
    NCBI RefSeq:NM_022519.2
    RefSeq ORF Size:1236bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 with N terminal Flag tag.
    Gene Synonym:Pi; AAT; Spi1
    Species:Rat
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SerpinA1 qPCR primers for gene expression analysis, RP300440 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    SerpinA1, also known as Alpha-1 antitrypsin (AAT), is a prototype member of the Serpin superfamily of the serine protease inhibitors. This serine protease inhibitor blocks the protease, neutrophil elastase. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. SerpinA1 (alpha1-antitrypsin), an acute phase protein and the classical neutrophil elastase inhibitor, is localized within lipid rafts in primary human monocytes in vitro. It association with monocytes is inhibited by cholesterol depleting/efflux-stimulating agents (nystatin, filipin, MbetaCD (methyl-beta-cyclodextrin) and oxidized low-density lipoprotein (oxLDL) and conversely, enhanced by free cholesterol. Furthermore, SerpinA1/monocyte association per se depletes lipid raft cholesterol as characterized by the activation of extracellular signal-regulated kinase 2, formation of cytosolic lipid droplets, and a complete inhibition of oxLDL uptake by monocytes. Previous population studies have suggested that heterozygote status for the AAT gene (SerpinA1) is a risk factor for chronic rhinosinusitis with nasal polyposis (CRSwNP). Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SerpinA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin deficiency is an inherited disease affecting the lung and liver. In the liver, alpha-1 antitrypsin deficiency may manifest as benign neonatal hepatitis syndrome; a small percentage of adults develop liver fibrosis, with progression to cirrhosis and hepatocellular carcinoma. Its most important physiologic functions are the protection of pulmonary tissue from aggressive proteolytic enzymes and regulation of pulmonary immune processes.

    References
  • Khnlein T, et al. (2008) Alpha-1 antitrypsin deficiency: pathogenesis, clinical presentation, diagnosis, and treatment. Am J Med. 121(1): 3-9.
  • Camelier AA, et al. (2008) Alpha-1 antitrypsin deficiency: diagnosis and treatment. J Bras Pneumol. 34(7): 514-27.
  • Subramaniyam D, et al. (2010) Cholesterol rich lipid raft microdomains are gateway for acute phase protein, SERPINA1. Int J Biochem Cell Biol. 42(9): 1562-70.
  • Kilty SJ, et al. (2010) Polymorphisms in the SERPINA1 (Alpha-1-Antitrypsin) gene are associated with severe chronic rhinosinusitis unresponsive to medical therapy. Am J Rhinol Allergy. 24(1): e4-9.
  • Size / Price
    Catalog: RG80476-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"