SEPT2 cDNA ORF Clone, Rat, N-His tag

Cat: RG80514-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SEPT2 Reagents
CRO Services
Product recommended

All SEPT2 Reagents
SEPT2 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1086 bp
Description
Full length Clone DNA of Rat septin 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEPT2 Background Information
Full Name
septin 2

SEPT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SEPT2 cDNA ORF Clone in Cloning Vector, Rat RG80514-U
SEPT2 cDNA ORF Clone, Rat, untagged RG80514-UT
SEPT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80514-ACGLN
SEPT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80514-ACG
SEPT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80514-ANG
SEPT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80514-ACR
SEPT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80514-ANR
SEPT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80514-CF
SEPT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80514-NF
SEPT2 cDNA ORF Clone, Rat, C-His tag RG80514-CH
SEPT2 cDNA ORF Clone, Rat, C-HA tag RG80514-CY
SEPT2 cDNA ORF Clone, Rat, N-HA tag RG80514-NY
SEPT2 cDNA ORF Clone, Rat, C-Myc tag RG80514-CM
SEPT2 cDNA ORF Clone, Rat, N-Myc tag RG80514-NM
SEPT2 qPCR Primer Pairs, Rat RP300478

SEPT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SEPT2 cDNA ORF Clone in Cloning Vector, Mouse MG59587-U
SEPT2 cDNA ORF Clone, Mouse, untagged MG59587-UT
SEPT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59587-ACGLN
SEPT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59587-ACG
SEPT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59587-ANG
SEPT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59587-ACR
SEPT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59587-ANR
SEPT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59587-CF
SEPT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59587-NF
SEPT2 cDNA ORF Clone, Mouse, C-His tag MG59587-CH
SEPT2 cDNA ORF Clone, Mouse, N-His tag MG59587-NH
SEPT2 cDNA ORF Clone, Mouse, C-HA tag MG59587-CY
SEPT2 cDNA ORF Clone, Mouse, N-HA tag MG59587-NY
SEPT2 cDNA ORF Clone, Mouse, C-Myc tag MG59587-CM
SEPT2 cDNA ORF Clone, Mouse, N-Myc tag MG59587-NM

SEPT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SEPT2 cDNA ORF Clone in Cloning Vector, Human HG17472-U
SEPT2 cDNA ORF Clone, Human, untagged HG17472-UT
SEPT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17472-ACGLN
SEPT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG17472-ACG
SEPT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG17472-ANG
SEPT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG17472-ACR
SEPT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG17472-ANR
SEPT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17472-CF
SEPT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17472-NF
SEPT2 cDNA ORF Clone, Human, C-His tag HG17472-CH
SEPT2 cDNA ORF Clone, Human, N-His tag HG17472-NH
SEPT2 cDNA ORF Clone, Human, C-HA tag HG17472-CY
SEPT2 cDNA ORF Clone, Human, N-HA tag HG17472-NY
SEPT2 cDNA ORF Clone, Human, C-Myc tag HG17472-CM
SEPT2 cDNA ORF Clone, Human, N-Myc tag HG17472-NM
info info
添加购物车成功! 添加购物车失败!