SEPP1 cDNA ORF Clone, Rat, N-His tag

Cat: RG80562-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SEPP1 Reagents
CRO Services
Product recommended

All SEPP1 Reagents
SEPP1 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1158 bp
Description
Full length Clone DNA of Rat selenoprotein P, plasma, 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEPP1 Background Information
Full Name
selenoprotein P, plasma, 1

SEPP1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SEPP1 cDNA ORF Clone in Cloning Vector, Rhesus CG90611-G
SEPP1 cDNA ORF Clone, Rhesus, untagged CG90611-UT
SEPP1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90611-ACG
SEPP1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90611-ACGLN
SEPP1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90611-ACR
SEPP1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90611-CF
SEPP1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90611-NF
SEPP1 cDNA ORF Clone, Rhesus, C-His tag CG90611-CH
SEPP1 cDNA ORF Clone, Rhesus, N-His tag CG90611-NH
SEPP1 cDNA ORF Clone, Rhesus, C-HA tag CG90611-CY
SEPP1 cDNA ORF Clone, Rhesus, N-HA tag CG90611-NY
SEPP1 cDNA ORF Clone, Rhesus, C-Myc tag CG90611-CM
SEPP1 cDNA ORF Clone, Rhesus, N-Myc tag CG90611-NM

SEPP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SEPP1 cDNA ORF Clone in Cloning Vector, Rat RG80562-U
SEPP1 cDNA ORF Clone, Rat, untagged RG80562-UT
SEPP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80562-ACGLN
SEPP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80562-ACG
SEPP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80562-ACR
SEPP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80562-CF
SEPP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80562-NF
SEPP1 cDNA ORF Clone, Rat, C-His tag RG80562-CH
SEPP1 cDNA ORF Clone, Rat, C-HA tag RG80562-CY
SEPP1 cDNA ORF Clone, Rat, N-HA tag RG80562-NY
SEPP1 cDNA ORF Clone, Rat, C-Myc tag RG80562-CM
SEPP1 cDNA ORF Clone, Rat, N-Myc tag RG80562-NM
SEPP1 qPCR Primer Pairs, Rat RP300526

SEPP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SEPP1 cDNA ORF Clone in Cloning Vector, Mouse MG51545-U
SEPP1 cDNA ORF Clone, Mouse, untagged MG51545-UT
SEPP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51545-ACGLN
SEPP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51545-ACG
SEPP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51545-ANG
SEPP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51545-ACR
SEPP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51545-ANR
SEPP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51545-CF
SEPP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51545-NF
SEPP1 cDNA ORF Clone, Mouse, C-His tag MG51545-CH
SEPP1 cDNA ORF Clone, Mouse, N-His tag MG51545-NH
SEPP1 cDNA ORF Clone, Mouse, C-HA tag MG51545-CY
SEPP1 cDNA ORF Clone, Mouse, N-HA tag MG51545-NY
SEPP1 cDNA ORF Clone, Mouse, C-Myc tag MG51545-CM
SEPP1 cDNA ORF Clone, Mouse, N-Myc tag MG51545-NM
SEPP1 qPCR Primer Pairs, Mouse MP201429

SEPP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SEPP1 cDNA ORF Clone in Cloning Vector, Human HG13774-G
SEPP1 cDNA ORF Clone, Human, untagged HG13774-UT
SEPP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13774-ACG
SEPP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13774-ACGLN
SEPP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13774-ACR
SEPP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13774-CF
SEPP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13774-NF
SEPP1 cDNA ORF Clone, Human, C-His tag HG13774-CH
SEPP1 cDNA ORF Clone, Human, N-His tag HG13774-NH
SEPP1 cDNA ORF Clone, Human, C-HA tag HG13774-CY
SEPP1 cDNA ORF Clone, Human, N-HA tag HG13774-NY
SEPP1 cDNA ORF Clone, Human, C-Myc tag HG13774-CM
SEPP1 cDNA ORF Clone, Human, N-Myc tag HG13774-NM
SEPP1 qPCR Primer Pairs, Human HP102449
info info
添加购物车成功! 添加购物车失败!