SEP15 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80886-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SEP15 Reagents
CRO Services
Product recommended

All SEP15 Reagents
SEP15 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
489 bp
Description
Full length Clone DNA of Rat selenoprotein 15 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEP15 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SEP15 cDNA ORF Clone in Cloning Vector, Rhesus CG90703-G
SEP15 cDNA ORF Clone, Rhesus, untagged CG90703-UT
SEP15 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90703-ACGLN
SEP15 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90703-ACG
SEP15 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90703-ACR
SEP15 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90703-CF
SEP15 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90703-NF
SEP15 cDNA ORF Clone, Rhesus, C-His tag CG90703-CH
SEP15 cDNA ORF Clone, Rhesus, N-His tag CG90703-NH
SEP15 cDNA ORF Clone, Rhesus, C-HA tag CG90703-CY
SEP15 cDNA ORF Clone, Rhesus, N-HA tag CG90703-NY
SEP15 cDNA ORF Clone, Rhesus, C-Myc tag CG90703-CM
SEP15 cDNA ORF Clone, Rhesus, N-Myc tag CG90703-NM

SEP15 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SEP15 cDNA ORF Clone in Cloning Vector, Rat RG80886-U
SEP15 cDNA ORF Clone, Rat, untagged RG80886-UT
SEP15 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80886-ACGLN
SEP15 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80886-ACG
SEP15 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80886-ACR
SEP15 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80886-CF
SEP15 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80886-NF
SEP15 cDNA ORF Clone, Rat, C-His tag RG80886-CH
SEP15 cDNA ORF Clone, Rat, N-His tag RG80886-NH
SEP15 cDNA ORF Clone, Rat, C-HA tag RG80886-CY
SEP15 cDNA ORF Clone, Rat, N-HA tag RG80886-NY
SEP15 cDNA ORF Clone, Rat, C-Myc tag RG80886-CM
SEP15 qPCR Primer Pairs, Rat RP300850

SEP15 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SEP15 cDNA ORF Clone in Cloning Vector, Mouse MG53456-U
SEP15 cDNA ORF Clone, Mouse, untagged MG53456-UT
SEP15 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53456-ACGLN
SEP15 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53456-ACG
SEP15 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53456-ACR
SEP15 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53456-CF
SEP15 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53456-NF
SEP15 cDNA ORF Clone, Mouse, C-His tag MG53456-CH
SEP15 cDNA ORF Clone, Mouse, N-His tag MG53456-NH
SEP15 cDNA ORF Clone, Mouse, C-HA tag MG53456-CY
SEP15 cDNA ORF Clone, Mouse, N-HA tag MG53456-NY
SEP15 cDNA ORF Clone, Mouse, C-Myc tag MG53456-CM
SEP15 cDNA ORF Clone, Mouse, N-Myc tag MG53456-NM

SEP15 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SEP15 cDNA ORF Clone in Cloning Vector, Human HG16247-G
SEP15 cDNA ORF Clone, Human, untagged HG16247-UT
SEP15 cDNA ORF Clone, Human, C-GFPSpark® tag HG16247-ACG
SEP15 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16247-ACGLN
SEP15 cDNA ORF Clone, Human, N-GFPSpark® tag HG16247-ANG
SEP15 cDNA ORF Clone, Human, C-OFPSpark® tag HG16247-ACR
SEP15 cDNA ORF Clone, Human, N-OFPSpark® tag HG16247-ANR
SEP15 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16247-CF
SEP15 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16247-NF
SEP15 cDNA ORF Clone, Human, C-His tag HG16247-CH
SEP15 cDNA ORF Clone, Human, N-His tag HG16247-NH
SEP15 cDNA ORF Clone, Human, C-HA tag HG16247-CY
SEP15 cDNA ORF Clone, Human, N-HA tag HG16247-NY
SEP15 cDNA ORF Clone, Human, C-Myc tag HG16247-CM
SEP15 cDNA ORF Clone, Human, N-Myc tag HG16247-NM
SEP15 qPCR Primer Pairs, Human HP105011
info info
添加购物车成功! 添加购物车失败!