Semaphorin 4D cDNA ORF Clone, Rat, untagged

Cat: RG80320-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Semaphorin 4D Reagents
CRO Services
Product recommended

All Semaphorin 4D Reagents
Semaphorin 4D cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2589 bp
Description
Full length Clone DNA of Rat sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Semaphorin 4D Background Information
Full Name
semaphorin 4D

Semaphorin 4D cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Semaphorin 4D cDNA ORF Clone in Cloning Vector, Rhesus CG90209-G
Semaphorin 4D cDNA ORF Clone, Rhesus, untagged CG90209-UT
Semaphorin 4D cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90209-ACG
Semaphorin 4D Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90209-ACGLN
Semaphorin 4D cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90209-ACR
Semaphorin 4D cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90209-CF
Semaphorin 4D cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90209-NF
Semaphorin 4D cDNA ORF Clone, Rhesus, C-His tag CG90209-CH
Semaphorin 4D cDNA ORF Clone, Rhesus, N-His tag CG90209-NH
Semaphorin 4D cDNA ORF Clone, Rhesus, C-HA tag CG90209-CY
Semaphorin 4D cDNA ORF Clone, Rhesus, N-HA tag CG90209-NY
Semaphorin 4D cDNA ORF Clone, Rhesus, C-Myc tag CG90209-CM
Semaphorin 4D cDNA ORF Clone, Rhesus, N-Myc tag CG90209-NM

Semaphorin 4D cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Semaphorin 4D cDNA ORF Clone in Cloning Vector, Rat RG80320-G
Semaphorin 4D Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80320-ACGLN
Semaphorin 4D cDNA ORF Clone, Rat, C-GFPSpark® tag RG80320-ACG
Semaphorin 4D cDNA ORF Clone, Rat, C-OFPSpark® tag RG80320-ACR
Semaphorin 4D cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80320-CF
Semaphorin 4D cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80320-NF
Semaphorin 4D cDNA ORF Clone, Rat, C-His tag RG80320-CH
Semaphorin 4D cDNA ORF Clone, Rat, N-His tag RG80320-NH
Semaphorin 4D cDNA ORF Clone, Rat, C-HA tag RG80320-CY
Semaphorin 4D cDNA ORF Clone, Rat, N-HA tag RG80320-NY
Semaphorin 4D cDNA ORF Clone, Rat, C-Myc tag RG80320-CM
Semaphorin 4D cDNA ORF Clone, Rat, N-Myc tag RG80320-NM
Semaphorin 4D qPCR Primer Pairs, Rat RP300291

Semaphorin 4D cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Semaphorin 4D cDNA ORF Clone in Cloning Vector, Mouse MG50642-M
Semaphorin 4D cDNA ORF Clone, Mouse, untagged MG50642-UT
Semaphorin 4D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50642-ACG
Semaphorin 4D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50642-ACGLN
Semaphorin 4D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50642-ACR
Semaphorin 4D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50642-CF
Semaphorin 4D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50642-NF
Semaphorin 4D cDNA ORF Clone, Mouse, C-His tag MG50642-CH
Semaphorin 4D cDNA ORF Clone, Mouse, N-His tag MG50642-NH
Semaphorin 4D cDNA ORF Clone, Mouse, C-HA tag MG50642-CY
Semaphorin 4D cDNA ORF Clone, Mouse, N-HA tag MG50642-NY
Semaphorin 4D cDNA ORF Clone, Mouse, C-Myc tag MG50642-CM
Semaphorin 4D cDNA ORF Clone, Mouse, N-Myc tag MG50642-NM
Semaphorin 4D qPCR Primer Pairs, Mouse MP200622

Semaphorin 4D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Semaphorin 4D cDNA ORF Clone, Human, untagged HG11825-UT
Semaphorin 4D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11825-ACGLN
Semaphorin 4D qPCR Primer Pairs, Human HP104601
info info
添加购物车成功! 添加购物车失败!