SELENBP1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80981-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SELENBP1 Reagents
CRO Services
Product recommended

All SELENBP1 Reagents
SELENBP1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1419 bp
Description
Full length Clone DNA of Rat selenium binding protein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SELENBP1 Background Information
Full Name
selenium binding protein 1

SELENBP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SELENBP1 cDNA ORF Clone in Cloning Vector, Rat RG80981-G
SELENBP1 cDNA ORF Clone, Rat, untagged RG80981-UT
SELENBP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80981-ACG
SELENBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80981-ACGLN
SELENBP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80981-ANG
SELENBP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80981-ACR
SELENBP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80981-ANR
SELENBP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80981-CF
SELENBP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80981-NF
SELENBP1 cDNA ORF Clone, Rat, C-His tag RG80981-CH
SELENBP1 cDNA ORF Clone, Rat, N-His tag RG80981-NH
SELENBP1 cDNA ORF Clone, Rat, C-HA tag RG80981-CY
SELENBP1 cDNA ORF Clone, Rat, N-HA tag RG80981-NY
SELENBP1 cDNA ORF Clone, Rat, C-Myc tag RG80981-CM
SELENBP1 qPCR Primer Pairs, Rat RP300945

SELENBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SELENBP1 cDNA ORF Clone in Cloning Vector, Mouse MG51365-G
SELENBP1 cDNA ORF Clone, Mouse, untagged MG51365-UT
SELENBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51365-ACG
SELENBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51365-ACGLN
SELENBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51365-ANG
SELENBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51365-ACR
SELENBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51365-ANR
SELENBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51365-CF
SELENBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51365-NF
SELENBP1 cDNA ORF Clone, Mouse, C-His tag MG51365-CH
SELENBP1 cDNA ORF Clone, Mouse, N-His tag MG51365-NH
SELENBP1 cDNA ORF Clone, Mouse, C-HA tag MG51365-CY
SELENBP1 cDNA ORF Clone, Mouse, N-HA tag MG51365-NY
SELENBP1 cDNA ORF Clone, Mouse, C-Myc tag MG51365-CM
SELENBP1 cDNA ORF Clone, Mouse, N-Myc tag MG51365-NM
SELENBP1 qPCR Primer Pairs, Mouse MP201241

SELENBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SELENBP1 cDNA ORF Clone in Cloning Vector, Human HG14123-G
SELENBP1 cDNA ORF Clone, Human, untagged HG14123-UT
SELENBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14123-ACG
SELENBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14123-ACGLN
SELENBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14123-ANG
SELENBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14123-ACR
SELENBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14123-ANR
SELENBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14123-CF
SELENBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14123-NF
SELENBP1 cDNA ORF Clone, Human, C-His tag HG14123-CH
SELENBP1 cDNA ORF Clone, Human, N-His tag HG14123-NH
SELENBP1 cDNA ORF Clone, Human, C-HA tag HG14123-CY
SELENBP1 cDNA ORF Clone, Human, N-HA tag HG14123-NY
SELENBP1 cDNA ORF Clone, Human, C-Myc tag HG14123-CM
SELENBP1 cDNA ORF Clone, Human, N-Myc tag HG14123-NM
SELENBP1 qPCR Primer Pairs, Human HP102776
info info
添加购物车成功! 添加购物车失败!