Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81269-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Shwachman Bodian-Diamond syndrome Reagents
CRO Services
Product recommended

All Shwachman Bodian-Diamond syndrome Reagents
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
753 bp
Description
Full length Clone DNA of Rat Shwachman-Bodian-Diamond syndrome with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Shwachman Bodian-Diamond syndrome Background Information
Full Name
Shwachman-Bodian-Diamond syndrome

Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Shwachman Bodian-Diamond syndrome cDNA ORF Clone in Cloning Vector, Rat RG81269-U
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, untagged RG81269-UT
Shwachman Bodian-Diamond syndrome Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81269-ACGLN
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, C-GFPSpark® tag RG81269-ACG
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, N-GFPSpark® tag RG81269-ANG
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, C-OFPSpark® tag RG81269-ACR
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, N-OFPSpark® tag RG81269-ANR
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81269-NF
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, C-His tag RG81269-CH
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, N-His tag RG81269-NH
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, C-HA tag RG81269-CY
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, N-HA tag RG81269-NY
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, C-Myc tag RG81269-CM
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Rat, N-Myc tag RG81269-NM
Shwachman Bodian-Diamond syndrome qPCR Primer Pairs, Rat RP301225

Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Shwachman Bodian-Diamond syndrome cDNA ORF Clone in Cloning Vector, Mouse MG51234-U
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, untagged MG51234-UT
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51234-ACG
Shwachman Bodian-Diamond syndrome Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51234-ACGLN
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51234-ANG
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51234-ACR
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51234-ANR
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51234-CF
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51234-NF
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, C-His tag MG51234-CH
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, N-His tag MG51234-NH
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, C-HA tag MG51234-CY
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, N-HA tag MG51234-NY
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, C-Myc tag MG51234-CM
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Mouse, N-Myc tag MG51234-NM
Shwachman Bodian-Diamond syndrome qPCR Primer Pairs, Mouse MP201117

Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Shwachman Bodian-Diamond syndrome cDNA ORF Clone in Cloning Vector, Human HG15362-G
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, untagged HG15362-UT
Shwachman Bodian-Diamond syndrome Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15362-ACGLN
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, C-GFPSpark® tag HG15362-ACG
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, N-GFPSpark® tag HG15362-ANG
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, C-OFPSpark® tag HG15362-ACR
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, N-OFPSpark® tag HG15362-ANR
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15362-CF
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15362-NF
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, C-His tag HG15362-CH
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, N-His tag HG15362-NH
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, C-HA tag HG15362-CY
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, N-HA tag HG15362-NY
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, C-Myc tag HG15362-CM
Shwachman Bodian-Diamond syndrome cDNA ORF Clone, Human, N-Myc tag HG15362-NM
Shwachman Bodian-Diamond syndrome qPCR Primer Pairs, Human HP103986
info info
添加购物车成功! 添加购物车失败!