After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat SBDS cDNA Clone Product Information
NCBI RefSeq:NM_001008289.1
RefSeq ORF Size:753bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Shwachman-Bodian-Diamond syndrome.
Gene Synonym:Sbds
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid on other vectors
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-GFPSpark tagRG81269-ACG$225
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-OFPSpark tagRG81269-ACR$225
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-GFPSpark tagRG81269-ANG$225
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-OFPSpark tagRG81269-ANR$225
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-Flag tagRG81269-CF$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-His tagRG81269-CH$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-Myc tagRG81269-CM$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, C-HA tagRG81269-CY$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-Flag tagRG81269-NF$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-His tagRG81269-NH$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-Myc tagRG81269-NM$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmid, N-HA tagRG81269-NY$195
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone in cloning vectorRG81269-U$75
Rat SBDS / Shwachman-Bodian-Diamond syndrome Gene ORF cDNA clone expression plasmidRG81269-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: RG81269-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"