SARS cDNA ORF Clone, Rat, C-HA tag

Cat: RG80676-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SARS Reagents
CRO Services
Product recommended

All SARS Reagents
SARS cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1539 bp
Description
Full length Clone DNA of Rat seryl-tRNA synthetase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SARS Background Information
Full Name
seryl-tRNA synthetase

SARS cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SARS cDNA ORF Clone in Cloning Vector, Rat RG80676-U
SARS cDNA ORF Clone, Rat, untagged RG80676-UT
SARS cDNA ORF Clone, Rat, C-GFPSpark® tag RG80676-ACG
SARS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80676-ACGLN
SARS cDNA ORF Clone, Rat, N-GFPSpark® tag RG80676-ANG
SARS cDNA ORF Clone, Rat, C-OFPSpark® tag RG80676-ACR
SARS cDNA ORF Clone, Rat, N-OFPSpark® tag RG80676-ANR
SARS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80676-CF
SARS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80676-NF
SARS cDNA ORF Clone, Rat, C-His tag RG80676-CH
SARS cDNA ORF Clone, Rat, N-His tag RG80676-NH
SARS cDNA ORF Clone, Rat, N-HA tag RG80676-NY
SARS cDNA ORF Clone, Rat, C-Myc tag RG80676-CM
SARS cDNA ORF Clone, Rat, N-Myc tag RG80676-NM
SARS qPCR Primer Pairs, Rat RP300640

SARS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SARS cDNA ORF Clone in Cloning Vector, Mouse MG51421-U
SARS cDNA ORF Clone, Mouse, untagged MG51421-UT
SARS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51421-ACG
SARS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51421-ACGLN
SARS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51421-ANG
SARS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51421-ACR
SARS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51421-ANR
SARS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51421-CF
SARS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51421-NF
SARS cDNA ORF Clone, Mouse, C-His tag MG51421-CH
SARS cDNA ORF Clone, Mouse, N-His tag MG51421-NH
SARS cDNA ORF Clone, Mouse, C-HA tag MG51421-CY
SARS cDNA ORF Clone, Mouse, N-HA tag MG51421-NY
SARS cDNA ORF Clone, Mouse, C-Myc tag MG51421-CM
SARS cDNA ORF Clone, Mouse, N-Myc tag MG51421-NM
SARS qPCR Primer Pairs, Mouse MP201305

SARS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SARS cDNA ORF Clone in Cloning Vector, Human HG14473-G
SARS cDNA ORF Clone, Human, untagged HG14473-UT
SARS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14473-ACGLN
SARS cDNA ORF Clone, Human, C-GFPSpark® tag HG14473-ACG
SARS cDNA ORF Clone, Human, N-GFPSpark® tag HG14473-ANG
SARS cDNA ORF Clone, Human, C-OFPSpark® tag HG14473-ACR
SARS cDNA ORF Clone, Human, N-OFPSpark® tag HG14473-ANR
SARS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14473-CF
SARS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14473-NF
SARS cDNA ORF Clone, Human, C-His tag HG14473-CH
SARS cDNA ORF Clone, Human, N-His tag HG14473-NH
SARS cDNA ORF Clone, Human, C-HA tag HG14473-CY
SARS cDNA ORF Clone, Human, N-HA tag HG14473-NY
SARS cDNA ORF Clone, Human, C-Myc tag HG14473-CM
SARS cDNA ORF Clone, Human, N-Myc tag HG14473-NM
SARS qPCR Primer Pairs, Human HP103121
info info
添加购物车成功! 添加购物车失败!