SARNP cDNA ORF Clone, Rat, N-HA tag

Cat: RG80761-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SARNP Reagents
CRO Services
Product recommended

All SARNP Reagents
SARNP cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
633 bp
Description
Full length Clone DNA of Rat SAP domain containing ribonucleoprotein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SARNP Background Information
Full Name
SAP domain containing ribonucleoprotein

SARNP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SARNP cDNA ORF Clone in Cloning Vector, Rat RG80761-U
SARNP cDNA ORF Clone, Rat, untagged RG80761-UT
SARNP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80761-ACG
SARNP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80761-ACGLN
SARNP cDNA ORF Clone, Rat, N-GFPSpark® tag RG80761-ANG
SARNP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80761-ACR
SARNP cDNA ORF Clone, Rat, N-OFPSpark® tag RG80761-ANR
SARNP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80761-CF
SARNP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80761-NF
SARNP cDNA ORF Clone, Rat, C-His tag RG80761-CH
SARNP cDNA ORF Clone, Rat, N-His tag RG80761-NH
SARNP cDNA ORF Clone, Rat, C-HA tag RG80761-CY
SARNP cDNA ORF Clone, Rat, C-Myc tag RG80761-CM
SARNP cDNA ORF Clone, Rat, N-Myc tag RG80761-NM
SARNP qPCR Primer Pairs, Rat RP300725

SARNP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SARNP cDNA ORF Clone in Cloning Vector, Mouse MG53066-G
SARNP cDNA ORF Clone, Mouse, untagged MG53066-UT
SARNP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53066-ACG
SARNP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53066-ACGLN
SARNP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53066-ANG
SARNP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53066-ACR
SARNP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53066-ANR
SARNP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53066-CF
SARNP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53066-NF
SARNP cDNA ORF Clone, Mouse, C-His tag MG53066-CH
SARNP cDNA ORF Clone, Mouse, N-His tag MG53066-NH
SARNP cDNA ORF Clone, Mouse, C-HA tag MG53066-CY
SARNP cDNA ORF Clone, Mouse, N-HA tag MG53066-NY
SARNP cDNA ORF Clone, Mouse, C-Myc tag MG53066-CM
SARNP cDNA ORF Clone, Mouse, N-Myc tag MG53066-NM

SARNP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SARNP cDNA ORF Clone in Cloning Vector, Human HG14972-G
SARNP cDNA ORF Clone, Human, untagged HG14972-UT
SARNP cDNA ORF Clone, Human, C-GFPSpark® tag HG14972-ACG
SARNP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14972-ACGLN
SARNP cDNA ORF Clone, Human, N-GFPSpark® tag HG14972-ANG
SARNP cDNA ORF Clone, Human, C-OFPSpark® tag HG14972-ACR
SARNP cDNA ORF Clone, Human, N-OFPSpark® tag HG14972-ANR
SARNP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14972-CF
SARNP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14972-NF
SARNP cDNA ORF Clone, Human, C-His tag HG14972-CH
SARNP cDNA ORF Clone, Human, N-His tag HG14972-NH
SARNP cDNA ORF Clone, Human, C-HA tag HG14972-CY
SARNP cDNA ORF Clone, Human, N-HA tag HG14972-NY
SARNP cDNA ORF Clone, Human, C-Myc tag HG14972-CM
SARNP cDNA ORF Clone, Human, N-Myc tag HG14972-NM
SARNP qPCR Primer Pairs, Human HP103601
info info
添加购物车成功! 添加购物车失败!