SAR1B cDNA ORF Clone, Rat, C-His tag

Cat: RG81083-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SAR1B Reagents
CRO Services
Product recommended

All SAR1B Reagents
SAR1B cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Rat SAR1 homolog B (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SAR1B Background Information
Full Name
secretion associated, Ras related GTPase 1B

SAR1B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SAR1B cDNA ORF Clone in Cloning Vector, Rat RG81083-U
SAR1B cDNA ORF Clone, Rat, untagged RG81083-UT
SAR1B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81083-ACGLN
SAR1B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81083-ACG
SAR1B cDNA ORF Clone, Rat, N-GFPSpark® tag RG81083-ANG
SAR1B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81083-ACR
SAR1B cDNA ORF Clone, Rat, N-OFPSpark® tag RG81083-ANR
SAR1B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81083-CF
SAR1B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81083-NF
SAR1B cDNA ORF Clone, Rat, N-His tag RG81083-NH
SAR1B cDNA ORF Clone, Rat, C-HA tag RG81083-CY
SAR1B cDNA ORF Clone, Rat, N-HA tag RG81083-NY
SAR1B cDNA ORF Clone, Rat, C-Myc tag RG81083-CM
SAR1B cDNA ORF Clone, Rat, N-Myc tag RG81083-NM
SAR1B qPCR Primer Pairs, Rat RP301040

SAR1B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SAR1B cDNA ORF Clone in Cloning Vector, Mouse MG53683-U
SAR1B cDNA ORF Clone, Mouse, untagged MG53683-UT
SAR1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53683-ACGLN
SAR1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53683-ACG
SAR1B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53683-ANG
SAR1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53683-ACR
SAR1B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53683-ANR
SAR1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53683-CF
SAR1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53683-NF
SAR1B cDNA ORF Clone, Mouse, C-His tag MG53683-CH
SAR1B cDNA ORF Clone, Mouse, N-His tag MG53683-NH
SAR1B cDNA ORF Clone, Mouse, C-HA tag MG53683-CY
SAR1B cDNA ORF Clone, Mouse, N-HA tag MG53683-NY
SAR1B cDNA ORF Clone, Mouse, C-Myc tag MG53683-CM
SAR1B cDNA ORF Clone, Mouse, N-Myc tag MG53683-NM

SAR1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SAR1B cDNA ORF Clone in Cloning Vector, Human HG13608-G
SAR1B cDNA ORF Clone, Human, untagged HG13608-UT
SAR1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13608-ACGLN
SAR1B cDNA ORF Clone, Human, C-GFPSpark® tag HG13608-ACG
SAR1B cDNA ORF Clone, Human, N-GFPSpark® tag HG13608-ANG
SAR1B cDNA ORF Clone, Human, C-OFPSpark® tag HG13608-ACR
SAR1B cDNA ORF Clone, Human, N-OFPSpark® tag HG13608-ANR
SAR1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13608-CF
SAR1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13608-NF
SAR1B cDNA ORF Clone, Human, C-His tag HG13608-CH
SAR1B cDNA ORF Clone, Human, N-His tag HG13608-NH
SAR1B cDNA ORF Clone, Human, C-HA tag HG13608-CY
SAR1B cDNA ORF Clone, Human, N-HA tag HG13608-NY
SAR1B cDNA ORF Clone, Human, C-Myc tag HG13608-CM
SAR1B cDNA ORF Clone, Human, N-Myc tag HG13608-NM
SAR1B qPCR Primer Pairs, Human HP102293
info info
添加购物车成功! 添加购物车失败!