SAR1A cDNA ORF Clone, Rat, N-His tag

Cat: RG80552-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SAR1A Reagents
CRO Services
Product recommended

All SAR1A Reagents
SAR1A cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Rat SAR1 homolog A (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SAR1A Background Information
Full Name
secretion associated, Ras related GTPase 1A

SAR1A cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
SAR1A cDNA ORF Clone in Cloning Vector, Rabbit TG65030-G
SAR1A cDNA ORF Clone, Rabbit, untagged TG65030-UT
SAR1A cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65030-ACG
SAR1A cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65030-ANG
SAR1A cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65030-ACR
SAR1A cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65030-ANR
SAR1A cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65030-CF
SAR1A cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65030-NF
SAR1A cDNA ORF Clone, Rabbit, C-His tag TG65030-CH
SAR1A cDNA ORF Clone, Rabbit, N-His tag TG65030-NH
SAR1A cDNA ORF Clone, Rabbit, C-HA tag TG65030-CY
SAR1A cDNA ORF Clone, Rabbit, N-HA tag TG65030-NY
SAR1A cDNA ORF Clone, Rabbit, C-Myc tag TG65030-CM
SAR1A cDNA ORF Clone, Rabbit, N-Myc tag TG65030-NM

SAR1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SAR1A cDNA ORF Clone in Cloning Vector, Rat RG80552-G
SAR1A cDNA ORF Clone, Rat, untagged RG80552-UT
SAR1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80552-ACG
SAR1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80552-ACGLN
SAR1A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80552-ANG
SAR1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80552-ACR
SAR1A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80552-ANR
SAR1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80552-CF
SAR1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80552-NF
SAR1A cDNA ORF Clone, Rat, C-His tag RG80552-CH
SAR1A cDNA ORF Clone, Rat, C-HA tag RG80552-CY
SAR1A cDNA ORF Clone, Rat, N-HA tag RG80552-NY
SAR1A cDNA ORF Clone, Rat, C-Myc tag RG80552-CM
SAR1A cDNA ORF Clone, Rat, N-Myc tag RG80552-NM
SAR1A qPCR Primer Pairs, Rat RP300516

SAR1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SAR1A cDNA ORF Clone in Cloning Vector, Mouse MG53130-G
SAR1A cDNA ORF Clone, Mouse, untagged MG53130-UT
SAR1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53130-ACG
SAR1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53130-ACGLN
SAR1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53130-ANG
SAR1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53130-ACR
SAR1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53130-ANR
SAR1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53130-CF
SAR1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53130-NF
SAR1A cDNA ORF Clone, Mouse, C-His tag MG53130-CH
SAR1A cDNA ORF Clone, Mouse, N-His tag MG53130-NH
SAR1A cDNA ORF Clone, Mouse, C-HA tag MG53130-CY
SAR1A cDNA ORF Clone, Mouse, N-HA tag MG53130-NY
SAR1A cDNA ORF Clone, Mouse, C-Myc tag MG53130-CM
SAR1A cDNA ORF Clone, Mouse, N-Myc tag MG53130-NM

SAR1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SAR1A cDNA ORF Clone in Cloning Vector, Human HG16628-U
SAR1A cDNA ORF Clone, Human, untagged HG16628-UT
SAR1A cDNA ORF Clone, Human, C-GFPSpark® tag HG16628-ACG
SAR1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16628-ACGLN
SAR1A cDNA ORF Clone, Human, N-GFPSpark® tag HG16628-ANG
SAR1A cDNA ORF Clone, Human, C-OFPSpark® tag HG16628-ACR
SAR1A cDNA ORF Clone, Human, N-OFPSpark® tag HG16628-ANR
SAR1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16628-CF
SAR1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16628-NF
SAR1A cDNA ORF Clone, Human, C-His tag HG16628-CH
SAR1A cDNA ORF Clone, Human, N-His tag HG16628-NH
SAR1A cDNA ORF Clone, Human, C-HA tag HG16628-CY
SAR1A cDNA ORF Clone, Human, N-HA tag HG16628-NY
SAR1A cDNA ORF Clone, Human, C-Myc tag HG16628-CM
SAR1A cDNA ORF Clone, Human, N-Myc tag HG16628-NM
info info
添加购物车成功! 添加购物车失败!