RPAP3 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80573-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPAP3 Reagents
CRO Services
Product recommended

All RPAP3 Reagents
RPAP3 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1980 bp
Description
Full length Clone DNA of Rat RNA polymerase II associated protein 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPAP3 Background Information
Full Name
RNA polymerase II associated protein 3

RPAP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPAP3 cDNA ORF Clone in Cloning Vector, Rat RG80573-U
RPAP3 cDNA ORF Clone, Rat, untagged RG80573-UT
RPAP3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80573-ACG
RPAP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80573-ACGLN
RPAP3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80573-ANG
RPAP3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80573-ACR
RPAP3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80573-ANR
RPAP3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80573-CF
RPAP3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80573-NF
RPAP3 cDNA ORF Clone, Rat, C-His tag RG80573-CH
RPAP3 cDNA ORF Clone, Rat, N-His tag RG80573-NH
RPAP3 cDNA ORF Clone, Rat, C-HA tag RG80573-CY
RPAP3 cDNA ORF Clone, Rat, C-Myc tag RG80573-CM
RPAP3 cDNA ORF Clone, Rat, N-Myc tag RG80573-NM
RPAP3 qPCR Primer Pairs, Rat RP300537

RPAP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPAP3 cDNA ORF Clone in Cloning Vector, Mouse MG54302-U
RPAP3 cDNA ORF Clone, Mouse, untagged MG54302-UT
RPAP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54302-ACG
RPAP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54302-ACGLN
RPAP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54302-ANG
RPAP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54302-ACR
RPAP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54302-ANR
RPAP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54302-CF
RPAP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54302-NF
RPAP3 cDNA ORF Clone, Mouse, C-His tag MG54302-CH
RPAP3 cDNA ORF Clone, Mouse, N-His tag MG54302-NH
RPAP3 cDNA ORF Clone, Mouse, C-HA tag MG54302-CY
RPAP3 cDNA ORF Clone, Mouse, N-HA tag MG54302-NY
RPAP3 cDNA ORF Clone, Mouse, C-Myc tag MG54302-CM
RPAP3 cDNA ORF Clone, Mouse, N-Myc tag MG54302-NM

RPAP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPAP3 cDNA ORF Clone in Cloning Vector, Human HG21319-U
RPAP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21319-ACGLN
info info
添加购物车成功! 添加购物车失败!