ROGDI cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81175-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ROGDI Reagents
CRO Services
Product recommended

All ROGDI Reagents
ROGDI cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
864 bp
Description
Full length Clone DNA of Rat rogdi homolog (Drosophila) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ROGDI Background Information
Full Name
rogdi homolog (Drosophila)

ROGDI cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ROGDI cDNA ORF Clone in Cloning Vector, Rat RG81175-U
ROGDI cDNA ORF Clone, Rat, untagged RG81175-UT
ROGDI Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81175-ACGLN
ROGDI cDNA ORF Clone, Rat, C-GFPSpark® tag RG81175-ACG
ROGDI cDNA ORF Clone, Rat, N-GFPSpark® tag RG81175-ANG
ROGDI cDNA ORF Clone, Rat, C-OFPSpark® tag RG81175-ACR
ROGDI cDNA ORF Clone, Rat, N-OFPSpark® tag RG81175-ANR
ROGDI cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81175-NF
ROGDI cDNA ORF Clone, Rat, C-His tag RG81175-CH
ROGDI cDNA ORF Clone, Rat, N-His tag RG81175-NH
ROGDI cDNA ORF Clone, Rat, C-HA tag RG81175-CY
ROGDI cDNA ORF Clone, Rat, N-HA tag RG81175-NY
ROGDI cDNA ORF Clone, Rat, C-Myc tag RG81175-CM
ROGDI cDNA ORF Clone, Rat, N-Myc tag RG81175-NM
ROGDI qPCR Primer Pairs, Rat RP301131

ROGDI cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ROGDI cDNA ORF Clone in Cloning Vector, Mouse MG52006-G
ROGDI cDNA ORF Clone, Mouse, untagged MG52006-UT
ROGDI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52006-ACGLN
ROGDI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52006-ACG
ROGDI cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52006-ANG
ROGDI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52006-ACR
ROGDI cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52006-ANR
ROGDI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52006-CF
ROGDI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52006-NF
ROGDI cDNA ORF Clone, Mouse, C-His tag MG52006-CH
ROGDI cDNA ORF Clone, Mouse, N-His tag MG52006-NH
ROGDI cDNA ORF Clone, Mouse, C-HA tag MG52006-CY
ROGDI cDNA ORF Clone, Mouse, N-HA tag MG52006-NY
ROGDI cDNA ORF Clone, Mouse, C-Myc tag MG52006-CM
ROGDI cDNA ORF Clone, Mouse, N-Myc tag MG52006-NM
ROGDI qPCR Primer Pairs, Mouse MP201879

ROGDI cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ROGDI cDNA ORF Clone in Cloning Vector, Human HG14622-G
ROGDI cDNA ORF Clone, Human, untagged HG14622-UT
ROGDI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14622-ACGLN
ROGDI cDNA ORF Clone, Human, C-GFPSpark® tag HG14622-ACG
ROGDI cDNA ORF Clone, Human, N-GFPSpark® tag HG14622-ANG
ROGDI cDNA ORF Clone, Human, C-OFPSpark® tag HG14622-ACR
ROGDI cDNA ORF Clone, Human, N-OFPSpark® tag HG14622-ANR
ROGDI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14622-CF
ROGDI cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14622-NF
ROGDI cDNA ORF Clone, Human, C-His tag HG14622-CH
ROGDI cDNA ORF Clone, Human, N-His tag HG14622-NH
ROGDI cDNA ORF Clone, Human, C-HA tag HG14622-CY
ROGDI cDNA ORF Clone, Human, N-HA tag HG14622-NY
ROGDI cDNA ORF Clone, Human, C-Myc tag HG14622-CM
ROGDI cDNA ORF Clone, Human, N-Myc tag HG14622-NM
ROGDI qPCR Primer Pairs, Human HP103256
info info
添加购物车成功! 添加购物车失败!