RNF181 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81256-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNF181 Reagents
CRO Services
Product recommended

All RNF181 Reagents
RNF181 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
498 bp
Description
Full length Clone DNA of Rat ring finger protein 181 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNF181 Background Information
Full Name
ring finger protein 181

RNF181 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RNF181 cDNA ORF Clone in Cloning Vector, Rat RG81256-U
RNF181 cDNA ORF Clone, Rat, untagged RG81256-UT
RNF181 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81256-ACGLN
RNF181 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81256-ACG
RNF181 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81256-ANG
RNF181 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81256-ACR
RNF181 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81256-ANR
RNF181 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81256-NF
RNF181 cDNA ORF Clone, Rat, C-His tag RG81256-CH
RNF181 cDNA ORF Clone, Rat, N-His tag RG81256-NH
RNF181 cDNA ORF Clone, Rat, C-HA tag RG81256-CY
RNF181 cDNA ORF Clone, Rat, N-HA tag RG81256-NY
RNF181 cDNA ORF Clone, Rat, C-Myc tag RG81256-CM
RNF181 cDNA ORF Clone, Rat, N-Myc tag RG81256-NM
RNF181 qPCR Primer Pairs, Rat RP301212

RNF181 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNF181 cDNA ORF Clone in Cloning Vector, Mouse MG53492-G
RNF181 cDNA ORF Clone, Mouse, untagged MG53492-UT
RNF181 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53492-ACGLN
RNF181 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53492-ACG
RNF181 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53492-ANG
RNF181 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53492-ACR
RNF181 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53492-ANR
RNF181 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53492-CF
RNF181 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53492-NF
RNF181 cDNA ORF Clone, Mouse, C-His tag MG53492-CH
RNF181 cDNA ORF Clone, Mouse, N-His tag MG53492-NH
RNF181 cDNA ORF Clone, Mouse, C-HA tag MG53492-CY
RNF181 cDNA ORF Clone, Mouse, N-HA tag MG53492-NY
RNF181 cDNA ORF Clone, Mouse, C-Myc tag MG53492-CM
RNF181 cDNA ORF Clone, Mouse, N-Myc tag MG53492-NM
info info
添加购物车成功! 添加购物车失败!