RIOK3 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81247-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RIOK3 Reagents
CRO Services
Product recommended

All RIOK3 Reagents
RIOK3 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1560 bp
Description
Full length Clone DNA of Rat RIO kinase 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RIOK3 Background Information
Full Name
RIO kinase 3

RIOK3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RIOK3 cDNA ORF Clone in Cloning Vector, Rat RG81247-U
RIOK3 cDNA ORF Clone, Rat, untagged RG81247-UT
RIOK3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81247-ACG
RIOK3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81247-ACGLN
RIOK3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81247-ANG
RIOK3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81247-ACR
RIOK3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81247-ANR
RIOK3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81247-CF
RIOK3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81247-NF
RIOK3 cDNA ORF Clone, Rat, C-His tag RG81247-CH
RIOK3 cDNA ORF Clone, Rat, N-His tag RG81247-NH
RIOK3 cDNA ORF Clone, Rat, C-HA tag RG81247-CY
RIOK3 cDNA ORF Clone, Rat, N-HA tag RG81247-NY
RIOK3 cDNA ORF Clone, Rat, N-Myc tag RG81247-NM
RIOK3 qPCR Primer Pairs, Rat RP301203

RIOK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RIOK3 cDNA ORF Clone in Cloning Vector, Human HG16571-U
RIOK3 cDNA ORF Clone, Human, untagged HG16571-UT
RIOK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16571-ACGLN
RIOK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16571-ACG
RIOK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16571-ANG
RIOK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16571-ACR
RIOK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16571-ANR
RIOK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16571-CF
RIOK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16571-NF
RIOK3 cDNA ORF Clone, Human, C-His tag HG16571-CH
RIOK3 cDNA ORF Clone, Human, N-His tag HG16571-NH
RIOK3 cDNA ORF Clone, Human, C-HA tag HG16571-CY
RIOK3 cDNA ORF Clone, Human, N-HA tag HG16571-NY
RIOK3 cDNA ORF Clone, Human, C-Myc tag HG16571-CM
RIOK3 cDNA ORF Clone, Human, N-Myc tag HG16571-NM
info info
添加购物车成功! 添加购物车失败!