RHD cDNA ORF Clone, Rat, C-HA tag

Cat: RG80510-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RHD Reagents
CRO Services
Product recommended

All RHD Reagents
RHD cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1269 bp
Description
Full length Clone DNA of Rat Rh blood group, D antigen with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RHD Background Information
Full Name
Rh blood group D antigen

RHD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RHD cDNA ORF Clone in Cloning Vector, Rat RG80510-U
RHD cDNA ORF Clone, Rat, untagged RG80510-UT
RHD cDNA ORF Clone, Rat, C-GFPSpark® tag RG80510-ACG
RHD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80510-ACGLN
RHD cDNA ORF Clone, Rat, N-GFPSpark® tag RG80510-ANG
RHD cDNA ORF Clone, Rat, C-OFPSpark® tag RG80510-ACR
RHD cDNA ORF Clone, Rat, N-OFPSpark® tag RG80510-ANR
RHD cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80510-CF
RHD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80510-NF
RHD cDNA ORF Clone, Rat, C-His tag RG80510-CH
RHD cDNA ORF Clone, Rat, N-His tag RG80510-NH
RHD cDNA ORF Clone, Rat, N-HA tag RG80510-NY
RHD cDNA ORF Clone, Rat, C-Myc tag RG80510-CM
RHD cDNA ORF Clone, Rat, N-Myc tag RG80510-NM
RHD qPCR Primer Pairs, Rat RP300474

RHD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RHD cDNA ORF Clone in Cloning Vector, Mouse MG5A1158-U
RHD cDNA ORF Clone, Mouse, untagged MG5A1158-UT
RHD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1158-ACG
RHD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1158-ACGLN
RHD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1158-ANG
RHD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1158-ACR
RHD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1158-ANR
RHD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1158-CF
RHD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1158-NF
RHD cDNA ORF Clone, Mouse, C-His tag MG5A1158-CH
RHD cDNA ORF Clone, Mouse, N-His tag MG5A1158-NH
RHD cDNA ORF Clone, Mouse, C-HA tag MG5A1158-CY
RHD cDNA ORF Clone, Mouse, N-HA tag MG5A1158-NY
RHD cDNA ORF Clone, Mouse, C-Myc tag MG5A1158-CM
RHD cDNA ORF Clone, Mouse, N-Myc tag MG5A1158-NM

RHD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RHD cDNA ORF Clone, Human, untagged HG17804-UT
info info
添加购物车成功! 添加购物车失败!