RFC5 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80967-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RFC5 Reagents
CRO Services
Product recommended

All RFC5 Reagents
RFC5 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1017 bp
Description
Full length Clone DNA of Rat replication factor C (activator 1) 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RFC5 Background Information
Full Name
replication factor C (activator 1) 5, 36.5kDa

RFC5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RFC5 cDNA ORF Clone in Cloning Vector, Rat RG80967-U
RFC5 cDNA ORF Clone, Rat, untagged RG80967-UT
RFC5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80967-ACG
RFC5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80967-ACGLN
RFC5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80967-ANG
RFC5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80967-ACR
RFC5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80967-ANR
RFC5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80967-CF
RFC5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80967-NF
RFC5 cDNA ORF Clone, Rat, C-His tag RG80967-CH
RFC5 cDNA ORF Clone, Rat, N-His tag RG80967-NH
RFC5 cDNA ORF Clone, Rat, C-HA tag RG80967-CY
RFC5 cDNA ORF Clone, Rat, N-HA tag RG80967-NY
RFC5 cDNA ORF Clone, Rat, C-Myc tag RG80967-CM
RFC5 qPCR Primer Pairs, Rat RP300931

RFC5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RFC5 cDNA ORF Clone in Cloning Vector, Mouse MG5A4351-U
RFC5 cDNA ORF Clone, Mouse, untagged MG5A4351-UT
RFC5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4351-ACGLN
RFC5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4351-ACG
RFC5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4351-ANG
RFC5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4351-ACR
RFC5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4351-ANR
RFC5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4351-CF
RFC5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4351-NF
RFC5 cDNA ORF Clone, Mouse, C-His tag MG5A4351-CH
RFC5 cDNA ORF Clone, Mouse, N-His tag MG5A4351-NH
RFC5 cDNA ORF Clone, Mouse, C-HA tag MG5A4351-CY
RFC5 cDNA ORF Clone, Mouse, N-HA tag MG5A4351-NY
RFC5 cDNA ORF Clone, Mouse, C-Myc tag MG5A4351-CM
RFC5 cDNA ORF Clone, Mouse, N-Myc tag MG5A4351-NM
info info
添加购物车成功! 添加购物车失败!