RELT / TNFRSF19L cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80168-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RELT / TNFRSF19L Reagents
CRO Services
Product recommended

All RELT / TNFRSF19L Reagents
RELT / TNFRSF19L cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1284 bp
Description
Full length Clone DNA of Rat RELT tumor necrosis factor receptor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RELT / TNFRSF19L Background Information

Receptor expressed in lymphoid tissues (RELT), also known as tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1. RELT/TNFRSF19L is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. RELT/TNFRSF19L is a type I transmembrane glycoprotein with a cysteine-rich extracellular domain, possessing significant homology to other members of the TNFR superfamily, especially TNFRSF19, DR3, OX40, and LTbeta receptor. RELT/TNFRSF19L is able to activate the NF-kappaB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. RELT/TNFRSF19L is able to activate the NF-κB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. Although the soluble form of RELT fusion protein does not inhibit the one-way mixed lymphocyte reaction, immobilized RELT/TNFRSF19L is capable of costimulating T-cell proliferation in the presence of CD3 signaling.

Full Name
RELT tumor necrosis factor receptor
References
  • Sica GL, et al. (2001) RELT, a new member of the tumor necrosis factor receptor superfamily, is selectively expressed in hematopoietic tissues and activates transcription factor NF-kappaB. Blood. 97(9): 2702-7.
  • Polek TC, et al. (2006) The TNF receptor, RELT, binds SPAK and uses it to mediate p38 and JNK activation. Biochem Biophys Res Commun. 343(1): 125-34.
  • Cusick JK, et al. (2006) Identification of RELT homologues that associate with RELT and are phosphorylated by OSR1. Biochem Biophys Res Commun. 340(2): 535-43.
  • RELT / TNFRSF19L cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RELT / TNFRSF19L cDNA ORF Clone in Cloning Vector, Rat RG80168-G
    RELT / TNFRSF19L cDNA ORF Clone, Rat, untagged RG80168-UT
    RELT / TNFRSF19L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80168-ACGLN
    RELT / TNFRSF19L cDNA ORF Clone, Rat, C-GFPSpark® tag RG80168-ACG
    RELT / TNFRSF19L cDNA ORF Clone, Rat, C-OFPSpark® tag RG80168-ACR
    RELT / TNFRSF19L cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80168-CF
    RELT / TNFRSF19L cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80168-NF
    RELT / TNFRSF19L cDNA ORF Clone, Rat, C-His tag RG80168-CH
    RELT / TNFRSF19L cDNA ORF Clone, Rat, N-His tag RG80168-NH
    RELT / TNFRSF19L cDNA ORF Clone, Rat, C-HA tag RG80168-CY
    RELT / TNFRSF19L cDNA ORF Clone, Rat, N-HA tag RG80168-NY
    RELT / TNFRSF19L cDNA ORF Clone, Rat, N-Myc tag RG80168-NM
    RELT / TNFRSF19L qPCR Primer Pairs, Rat RP300161

    RELT / TNFRSF19L cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RELT / TNFRSF19L cDNA ORF Clone in Cloning Vector, Mouse MG51142-G
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, untagged MG51142-UT
    RELT / TNFRSF19L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51142-ACGLN
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51142-ACG
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51142-ACR
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51142-CF
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51142-NF
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, C-His tag MG51142-CH
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, N-His tag MG51142-NH
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, C-HA tag MG51142-CY
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, N-HA tag MG51142-NY
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, C-Myc tag MG51142-CM
    RELT / TNFRSF19L cDNA ORF Clone, Mouse, N-Myc tag MG51142-NM

    RELT / TNFRSF19L cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RELT / TNFRSF19L cDNA ORF Clone in Cloning Vector, Human HG10401-M
    RELT / TNFRSF19L cDNA ORF Clone, Human, untagged HG10401-UT
    RELT / TNFRSF19L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10401-ACGLN
    RELT / TNFRSF19L cDNA ORF Clone, Human, C-GFPSpark® tag HG10401-ACG
    RELT / TNFRSF19L cDNA ORF Clone, Human, C-OFPSpark® tag HG10401-ACR
    RELT / TNFRSF19L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10401-CF
    RELT / TNFRSF19L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10401-NF
    RELT / TNFRSF19L cDNA ORF Clone, Human, C-His tag HG10401-CH
    RELT / TNFRSF19L cDNA ORF Clone, Human, N-His tag HG10401-NH
    RELT / TNFRSF19L cDNA ORF Clone, Human, C-HA tag HG10401-CY
    RELT / TNFRSF19L cDNA ORF Clone, Human, N-HA tag HG10401-NY
    RELT / TNFRSF19L cDNA ORF Clone, Human, C-Myc tag HG10401-CM
    RELT / TNFRSF19L cDNA ORF Clone, Human, N-Myc tag HG10401-NM
    RELT / TNFRSF19L qPCR Primer Pairs, Human HP100547
    info info
    添加购物车成功! 添加购物车失败!