Quick Order

Text Size:AAA

Rat RELT/TNFRSF19L Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat RELT cDNA Clone Product Information
NCBI RefSeq:NM_001108495.1
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Rattus norvegicus RELT tumor necrosis factor receptor with C terminal Myc tag.
Gene Synonym:Tnfrsf19l, Relt
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Receptor expressed in lymphoid tissues (RELT), also known as tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1. RELT/TNFRSF19L is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. RELT/TNFRSF19L is a type I transmembrane glycoprotein with a cysteine-rich extracellular domain, possessing significant homology to other members of the TNFR superfamily, especially TNFRSF19, DR3, OX40, and LTbeta receptor. RELT/TNFRSF19L is able to activate the NF-kappaB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. RELT/TNFRSF19L is able to activate the NF-κB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. Although the soluble form of RELT fusion protein does not inhibit the one-way mixed lymphocyte reaction, immobilized RELT/TNFRSF19L is capable of costimulating T-cell proliferation in the presence of CD3 signaling.

References
  • Sica GL, et al. (2001) RELT, a new member of the tumor necrosis factor receptor superfamily, is selectively expressed in hematopoietic tissues and activates transcription factor NF-kappaB. Blood. 97(9): 2702-7.
  • Polek TC, et al. (2006) The TNF receptor, RELT, binds SPAK and uses it to mediate p38 and JNK activation. Biochem Biophys Res Commun. 343(1): 125-34.
  • Cusick JK, et al. (2006) Identification of RELT homologues that associate with RELT and are phosphorylated by OSR1. Biochem Biophys Res Commun. 340(2): 535-43.
  • Size / Price
    Catalog: RG80168-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"