Quick Order

Rat REG3A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat REG3A cDNA Clone Product Information
NCBI RefSeq:NM_001145846.2
RefSeq ORF Size:525bp
cDNA Description:Full length Clone DNA of Rattus norvegicus regenerating islet-derived 3 alpha.
Gene Synonym:Pap2, PapII, Reg3a
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with REG3A qPCR primers for gene expression analysis, RP300243 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Regenerating islet-derived protein 3-alpha, also known as Regenerating islet-derived protein III-alpha, REG-3-alpha, REG3A, and HIP, is secreted protein which contains one C-type lectin domain. REG3A is constitutively expressed in intestine, and is a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It is overexpressed during the acute phase of pancreatitis and in some patients with chronic pancreatitis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. REG3A is also a stress protein involved in the control of bacterial proliferation. REG3A is down-regulated in most primary human gastric cancer cells, and might be useful in the diagnosis of gastric cancer. Additionally, REG3A is a target of beta-catenin signaling in Huh7 hepatoma cells. The REG1A and REG3A are downstream targets of the Wnt pathway during liver tumorigenesis.

References
  • Cavard C, et al. (2006) Overexpression of regenerating islet-derived 1 alpha and 3 alpha genes in human primary liver tumors with beta-catenin mutations. Oncogene. 25(4): 599-608.
  • Choi B, et al. (2007) Downregulation of regenerating islet-derived 3 alpha (REG3A) in primary human gastric adenocarcinomas. Exp Mol Med. 39(6): 796-804.
  • Size / Price
    Catalog: RG80258-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"