RASSF6 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80895-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RASSF6 Reagents
CRO Services
Product recommended

All RASSF6 Reagents
RASSF6 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1026 bp
Description
Full length Clone DNA of Rat Ras association (RalGDS/AF-6) domain family member 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RASSF6 Background Information
Full Name
Ras association (RalGDS/AF-6) domain family member 6

RASSF6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RASSF6 cDNA ORF Clone in Cloning Vector, Rat RG80895-U
RASSF6 cDNA ORF Clone, Rat, untagged RG80895-UT
RASSF6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80895-ACG
RASSF6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80895-ACGLN
RASSF6 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80895-ANG
RASSF6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80895-ACR
RASSF6 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80895-ANR
RASSF6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80895-CF
RASSF6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80895-NF
RASSF6 cDNA ORF Clone, Rat, C-His tag RG80895-CH
RASSF6 cDNA ORF Clone, Rat, N-His tag RG80895-NH
RASSF6 cDNA ORF Clone, Rat, C-HA tag RG80895-CY
RASSF6 cDNA ORF Clone, Rat, N-HA tag RG80895-NY
RASSF6 cDNA ORF Clone, Rat, C-Myc tag RG80895-CM
RASSF6 qPCR Primer Pairs, Rat RP300859

RASSF6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RASSF6 cDNA ORF Clone in Cloning Vector, Human HG15368-G
RASSF6 cDNA ORF Clone, Human, untagged HG15368-UT
RASSF6 cDNA ORF Clone, Human, C-GFPSpark® tag HG15368-ACG
RASSF6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15368-ACGLN
RASSF6 cDNA ORF Clone, Human, N-GFPSpark® tag HG15368-ANG
RASSF6 cDNA ORF Clone, Human, C-OFPSpark® tag HG15368-ACR
RASSF6 cDNA ORF Clone, Human, N-OFPSpark® tag HG15368-ANR
RASSF6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15368-CF
RASSF6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15368-NF
RASSF6 cDNA ORF Clone, Human, C-His tag HG15368-CH
RASSF6 cDNA ORF Clone, Human, N-His tag HG15368-NH
RASSF6 cDNA ORF Clone, Human, C-HA tag HG15368-CY
RASSF6 cDNA ORF Clone, Human, N-HA tag HG15368-NY
RASSF6 cDNA ORF Clone, Human, C-Myc tag HG15368-CM
RASSF6 cDNA ORF Clone, Human, N-Myc tag HG15368-NM
RASSF6 qPCR Primer Pairs, Human HP103992
info info
添加购物车成功! 添加购物车失败!