RAB26 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81321-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB26 Reagents
CRO Services
Product recommended

All RAB26 Reagents
RAB26 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
573 bp
Description
Full length Clone DNA of Rat RAB26, member RAS oncogene family with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB26 Background Information
Full Name
RAB26, member RAS oncogene family

RAB26 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB26 cDNA ORF Clone in Cloning Vector, Rat RG81321-G
RAB26 cDNA ORF Clone, Rat, untagged RG81321-UT
RAB26 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81321-ACGLN
RAB26 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81321-ACG
RAB26 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81321-ANG
RAB26 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81321-ACR
RAB26 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81321-ANR
RAB26 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81321-CF
RAB26 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81321-NF
RAB26 cDNA ORF Clone, Rat, C-His tag RG81321-CH
RAB26 cDNA ORF Clone, Rat, N-His tag RG81321-NH
RAB26 cDNA ORF Clone, Rat, C-HA tag RG81321-CY
RAB26 cDNA ORF Clone, Rat, N-HA tag RG81321-NY
RAB26 cDNA ORF Clone, Rat, N-Myc tag RG81321-NM
RAB26 qPCR Primer Pairs, Rat RP301292

RAB26 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB26 cDNA ORF Clone in Cloning Vector, Mouse MG52319-G
RAB26 cDNA ORF Clone, Mouse, untagged MG52319-UT
RAB26 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52319-ACG
RAB26 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52319-ACGLN
RAB26 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52319-ANG
RAB26 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52319-ACR
RAB26 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52319-ANR
RAB26 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52319-CF
RAB26 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52319-NF
RAB26 cDNA ORF Clone, Mouse, C-His tag MG52319-CH
RAB26 cDNA ORF Clone, Mouse, N-His tag MG52319-NH
RAB26 cDNA ORF Clone, Mouse, C-HA tag MG52319-CY
RAB26 cDNA ORF Clone, Mouse, N-HA tag MG52319-NY
RAB26 cDNA ORF Clone, Mouse, C-Myc tag MG52319-CM
RAB26 cDNA ORF Clone, Mouse, N-Myc tag MG52319-NM
RAB26 qPCR Primer Pairs, Mouse MP202192
info info
添加购物车成功! 添加购物车失败!