CD45 cDNA ORF Clone, Rat, N-His tag

Cat: RG80296-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD45 Reagents

CRO Services

Product recommended


All CD45 Reagents

CD45 cDNA ORF Clone, Rat, N-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3426 bp
Description
Full length Clone DNA of Rat protein tyrosine phosphatase, receptor type, C, transcript variant 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD45 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

Full Name
protein tyrosine phosphatase, receptor type, C
Research Areas
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • CD45 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD45 cDNA ORF Clone in Cloning Vector, Rat RG80296-G
    CD45 cDNA ORF Clone, Rat, untagged RG80296-UT
    CD45 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80296-ACGLN
    CD45 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80296-ACG
    CD45 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80296-ANG
    CD45 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80296-ACR
    CD45 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80296-ANR
    CD45 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80296-CF
    CD45 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80296-NF
    CD45 cDNA ORF Clone, Rat, C-His tag RG80296-CH
    CD45 cDNA ORF Clone, Rat, C-HA tag RG80296-CY
    CD45 cDNA ORF Clone, Rat, N-HA tag RG80296-NY
    CD45 cDNA ORF Clone, Rat, C-Myc tag RG80296-CM
    CD45 cDNA ORF Clone, Rat, N-Myc tag RG80296-NM
    CD45 qPCR Primer Pairs, Rat RP300272

    CD45 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD45 cDNA ORF Clone in Cloning Vector, Mouse MG50713-G
    CD45 cDNA ORF Clone, Mouse, untagged MG50713-UT
    CD45 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50713-ACGLN
    CD45 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50713-ACG
    CD45 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50713-ACR
    CD45 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50713-CF
    CD45 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50713-NF
    CD45 cDNA ORF Clone, Mouse, C-His tag MG50713-CH
    CD45 cDNA ORF Clone, Mouse, N-His tag MG50713-NH
    CD45 cDNA ORF Clone, Mouse, C-HA tag MG50713-CY
    CD45 cDNA ORF Clone, Mouse, N-HA tag MG50713-NY
    CD45 cDNA ORF Clone, Mouse, C-Myc tag MG50713-CM
    CD45 cDNA ORF Clone, Mouse, N-Myc tag MG50713-NM
    CD45 qPCR Primer Pairs, Mouse MP200688

    CD45 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD45 cDNA ORF Clone in Cloning Vector, Human HG10086-M
    CD45 cDNA ORF Clone in Cloning Vector, Human HG14197-G
    CD45 cDNA ORF Clone, Human, untagged HG10086-UT
    CD45 cDNA ORF Clone, Human, untagged HG14197-UT
    CD45 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14197-ACGLN
    CD45 cDNA ORF Clone, Human, C-GFPSpark® tag HG14197-ACG
    CD45 cDNA ORF Clone, Human, C-GFPSpark® tag HG10086-ACG
    CD45 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10086-ACGLN
    CD45 cDNA ORF Clone, Human, C-OFPSpark® tag HG10086-ACR
    CD45 cDNA ORF Clone, Human, C-OFPSpark® tag HG14197-ACR
    CD45 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14197-CF
    CD45 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10086-CF
    CD45 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14197-NF
    CD45 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10086-NF
    CD45 cDNA ORF Clone, Human, C-His tag HG10086-CH
    CD45 cDNA ORF Clone, Human, C-His tag HG14197-CH
    CD45 cDNA ORF Clone, Human, N-His tag HG10086-NH
    CD45 cDNA ORF Clone, Human, N-His tag HG14197-NH
    CD45 cDNA ORF Clone, Human, C-HA tag HG14197-CY
    CD45 cDNA ORF Clone, Human, C-HA tag HG10086-CY
    CD45 cDNA ORF Clone, Human, N-HA tag HG10086-NY
    CD45 cDNA ORF Clone, Human, N-HA tag HG14197-NY
    CD45 cDNA ORF Clone, Human, C-Myc tag HG14197-CM
    CD45 cDNA ORF Clone, Human, C-Myc tag HG10086-CM
    CD45 cDNA ORF Clone, Human, N-Myc tag HG10086-NM
    CD45 cDNA ORF Clone, Human, N-Myc tag HG14197-NM
    CD45 qPCR Primer Pairs, Human HP100852
    info info
    添加购物车成功! 添加购物车失败!