Quick Order

Rat Pleiotrophin / PTN / HB-GAM Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat PTN cDNA Clone Product Information
NCBI RefSeq:NM_017066.2
RefSeq ORF Size:507bp
cDNA Description:Full length Clone DNA of Rattus norvegicus pleiotrophin.
Gene Synonym:Hbnf
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.

References
  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
  • Size / Price
    Catalog: RG81121-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"