PSME1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80765-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSME1 Reagents
CRO Services
Product recommended

All PSME1 Reagents
PSME1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Rat proteasome (prosome, macropain) activator subunit 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSME1 Background Information

PA28A, also known as PSME1, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME1 gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring.

Full Name
proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
References
  • Honore B. et al., 1994, Eur J Biochem 218 (2): 421-30.
  • Wilkinson. et al., 2003, J. Biochem. (Germany) 270 (11): 2459-66.
  • Rual Jean-François. et al., 2005, Nature. (England) 437 (7062): 1173-8.
  • PSME1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    PSME1 cDNA ORF Clone in Cloning Vector, Canine DG70130-U

    PSME1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PSME1 cDNA ORF Clone in Cloning Vector, Rat RG80765-U
    PSME1 cDNA ORF Clone, Rat, untagged RG80765-UT
    PSME1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80765-ACGLN
    PSME1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80765-ACG
    PSME1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80765-ANG
    PSME1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80765-ACR
    PSME1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80765-ANR
    PSME1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80765-CF
    PSME1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80765-NF
    PSME1 cDNA ORF Clone, Rat, C-His tag RG80765-CH
    PSME1 cDNA ORF Clone, Rat, N-His tag RG80765-NH
    PSME1 cDNA ORF Clone, Rat, C-HA tag RG80765-CY
    PSME1 cDNA ORF Clone, Rat, N-HA tag RG80765-NY
    PSME1 cDNA ORF Clone, Rat, C-Myc tag RG80765-CM
    PSME1 qPCR Primer Pairs, Rat RP300729

    PSME1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PSME1 cDNA ORF Clone in Cloning Vector, Mouse MG59325-U
    PSME1 cDNA ORF Clone, Mouse, untagged MG59325-UT
    PSME1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59325-ACGLN
    PSME1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59325-ACG
    PSME1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59325-ANG
    PSME1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59325-ACR
    PSME1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59325-ANR
    PSME1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59325-CF
    PSME1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59325-NF
    PSME1 cDNA ORF Clone, Mouse, C-His tag MG59325-CH
    PSME1 cDNA ORF Clone, Mouse, N-His tag MG59325-NH
    PSME1 cDNA ORF Clone, Mouse, C-HA tag MG59325-CY
    PSME1 cDNA ORF Clone, Mouse, N-HA tag MG59325-NY
    PSME1 cDNA ORF Clone, Mouse, C-Myc tag MG59325-CM
    PSME1 cDNA ORF Clone, Mouse, N-Myc tag MG59325-NM

    PSME1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PSME1 cDNA ORF Clone in Cloning Vector, Human HG14654-G
    PSME1 cDNA ORF Clone, Human, untagged HG14654-UT
    PSME1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14654-ACGLN
    PSME1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14654-ACG
    PSME1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14654-ANG
    PSME1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14654-ACR
    PSME1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14654-ANR
    PSME1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14654-CF
    PSME1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14654-NF
    PSME1 cDNA ORF Clone, Human, C-His tag HG14654-CH
    PSME1 cDNA ORF Clone, Human, N-His tag HG14654-NH
    PSME1 cDNA ORF Clone, Human, C-HA tag HG14654-CY
    PSME1 cDNA ORF Clone, Human, N-HA tag HG14654-NY
    PSME1 cDNA ORF Clone, Human, C-Myc tag HG14654-CM
    PSME1 cDNA ORF Clone, Human, N-Myc tag HG14654-NM
    PSME1 qPCR Primer Pairs, Human HP103288
    info info
    添加购物车成功! 添加购物车失败!