PSMD2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80941-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMD2 Reagents
CRO Services
Product recommended

All PSMD2 Reagents
PSMD2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2727 bp
Description
Full length Clone DNA of Rat proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMD2 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2

PSMD2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMD2 cDNA ORF Clone in Cloning Vector, Rat RG80941-U
PSMD2 cDNA ORF Clone, Rat, untagged RG80941-UT
PSMD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80941-ACGLN
PSMD2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80941-ACG
PSMD2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80941-ANG
PSMD2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80941-ACR
PSMD2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80941-ANR
PSMD2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80941-CF
PSMD2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80941-NF
PSMD2 cDNA ORF Clone, Rat, C-His tag RG80941-CH
PSMD2 cDNA ORF Clone, Rat, N-His tag RG80941-NH
PSMD2 cDNA ORF Clone, Rat, C-HA tag RG80941-CY
PSMD2 cDNA ORF Clone, Rat, N-HA tag RG80941-NY
PSMD2 cDNA ORF Clone, Rat, C-Myc tag RG80941-CM
PSMD2 qPCR Primer Pairs, Rat RP300905

PSMD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMD2 cDNA ORF Clone in Cloning Vector, Mouse MG52505-G
PSMD2 cDNA ORF Clone, Mouse, untagged MG52505-UT
PSMD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52505-ACGLN
PSMD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52505-ACG
PSMD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52505-ANG
PSMD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52505-ACR
PSMD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52505-ANR
PSMD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52505-CF
PSMD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52505-NF
PSMD2 cDNA ORF Clone, Mouse, C-His tag MG52505-CH
PSMD2 cDNA ORF Clone, Mouse, N-His tag MG52505-NH
PSMD2 cDNA ORF Clone, Mouse, C-HA tag MG52505-CY
PSMD2 cDNA ORF Clone, Mouse, N-HA tag MG52505-NY
PSMD2 cDNA ORF Clone, Mouse, C-Myc tag MG52505-CM
PSMD2 cDNA ORF Clone, Mouse, N-Myc tag MG52505-NM
PSMD2 qPCR Primer Pairs, Mouse MP202378

PSMD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMD2 cDNA ORF Clone in Cloning Vector, Human HG17173-U
PSMD2 cDNA ORF Clone, Human, untagged HG17173-UT
PSMD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG17173-ACG
PSMD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17173-ACGLN
PSMD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG17173-ANG
PSMD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG17173-ACR
PSMD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG17173-ANR
PSMD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17173-CF
PSMD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17173-NF
PSMD2 cDNA ORF Clone, Human, C-His tag HG17173-CH
PSMD2 cDNA ORF Clone, Human, N-His tag HG17173-NH
PSMD2 cDNA ORF Clone, Human, C-HA tag HG17173-CY
PSMD2 cDNA ORF Clone, Human, N-HA tag HG17173-NY
PSMD2 cDNA ORF Clone, Human, C-Myc tag HG17173-CM
PSMD2 cDNA ORF Clone, Human, N-Myc tag HG17173-NM
info info
添加购物车成功! 添加购物车失败!